ID: 989577373

View in Genome Browser
Species Human (GRCh38)
Location 5:43000737-43000759
Sequence AACCAAAGTTCCAAGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989577368_989577373 -9 Left 989577368 5:43000723-43000745 CCCCTGGTGCCACCAACCAAAGT No data
Right 989577373 5:43000737-43000759 AACCAAAGTTCCAAGACTGCTGG No data
989577365_989577373 18 Left 989577365 5:43000696-43000718 CCTTTGAGAGTGTCAGCCTACTG No data
Right 989577373 5:43000737-43000759 AACCAAAGTTCCAAGACTGCTGG No data
989577367_989577373 2 Left 989577367 5:43000712-43000734 CCTACTGCTGTCCCCTGGTGCCA No data
Right 989577373 5:43000737-43000759 AACCAAAGTTCCAAGACTGCTGG No data
989577364_989577373 27 Left 989577364 5:43000687-43000709 CCGAGAAGACCTTTGAGAGTGTC No data
Right 989577373 5:43000737-43000759 AACCAAAGTTCCAAGACTGCTGG No data
989577369_989577373 -10 Left 989577369 5:43000724-43000746 CCCTGGTGCCACCAACCAAAGTT No data
Right 989577373 5:43000737-43000759 AACCAAAGTTCCAAGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989577373 Original CRISPR AACCAAAGTTCCAAGACTGC TGG Intergenic
No off target data available for this crispr