ID: 989581201

View in Genome Browser
Species Human (GRCh38)
Location 5:43034700-43034722
Sequence TGCTGGTGCCAGGACTATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989581198_989581201 -1 Left 989581198 5:43034678-43034700 CCTCAGGGGCGGGGTGGCTGGTT No data
Right 989581201 5:43034700-43034722 TGCTGGTGCCAGGACTATCACGG No data
989581189_989581201 24 Left 989581189 5:43034653-43034675 CCTGTTGATGTTGGGTAAGGATG No data
Right 989581201 5:43034700-43034722 TGCTGGTGCCAGGACTATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989581201 Original CRISPR TGCTGGTGCCAGGACTATCA CGG Intergenic
No off target data available for this crispr