ID: 989582422

View in Genome Browser
Species Human (GRCh38)
Location 5:43045310-43045332
Sequence TGGAGGATCCTCAAATACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989582422_989582427 1 Left 989582422 5:43045310-43045332 CCCTGGTATTTGAGGATCCTCCA No data
Right 989582427 5:43045334-43045356 TTGCCTTCTGGTCTTACAGACGG No data
989582422_989582428 2 Left 989582422 5:43045310-43045332 CCCTGGTATTTGAGGATCCTCCA No data
Right 989582428 5:43045335-43045357 TGCCTTCTGGTCTTACAGACGGG No data
989582422_989582431 20 Left 989582422 5:43045310-43045332 CCCTGGTATTTGAGGATCCTCCA No data
Right 989582431 5:43045353-43045375 ACGGGAGAATAAAGGAAAAATGG No data
989582422_989582430 12 Left 989582422 5:43045310-43045332 CCCTGGTATTTGAGGATCCTCCA No data
Right 989582430 5:43045345-43045367 TCTTACAGACGGGAGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989582422 Original CRISPR TGGAGGATCCTCAAATACCA GGG (reversed) Intergenic
No off target data available for this crispr