ID: 989582704

View in Genome Browser
Species Human (GRCh38)
Location 5:43047926-43047948
Sequence CTTCACCAGATTCCACAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989582701_989582704 30 Left 989582701 5:43047873-43047895 CCCATCAGTCAATATTTTGGACA No data
Right 989582704 5:43047926-43047948 CTTCACCAGATTCCACAGAGTGG No data
989582702_989582704 29 Left 989582702 5:43047874-43047896 CCATCAGTCAATATTTTGGACAG No data
Right 989582704 5:43047926-43047948 CTTCACCAGATTCCACAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989582704 Original CRISPR CTTCACCAGATTCCACAGAG TGG Intergenic
No off target data available for this crispr