ID: 989582705

View in Genome Browser
Species Human (GRCh38)
Location 5:43047927-43047949
Sequence TTCACCAGATTCCACAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989582702_989582705 30 Left 989582702 5:43047874-43047896 CCATCAGTCAATATTTTGGACAG No data
Right 989582705 5:43047927-43047949 TTCACCAGATTCCACAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989582705 Original CRISPR TTCACCAGATTCCACAGAGT GGG Intergenic
No off target data available for this crispr