ID: 989584815

View in Genome Browser
Species Human (GRCh38)
Location 5:43066509-43066531
Sequence TTCCCGGGCGACGCCGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989584815_989584819 -2 Left 989584815 5:43066509-43066531 CCAGCGCCGGCGTCGCCCGGGAA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 989584819 5:43066530-43066552 AACCCCAGACTCTGCGCAACTGG 0: 1
1: 0
2: 1
3: 4
4: 56
989584815_989584823 24 Left 989584815 5:43066509-43066531 CCAGCGCCGGCGTCGCCCGGGAA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 989584823 5:43066556-43066578 CGATTCCAAATCCCTCAGATCGG 0: 1
1: 0
2: 0
3: 1
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989584815 Original CRISPR TTCCCGGGCGACGCCGGCGC TGG (reversed) Intronic
900140329 1:1137072-1137094 TTCCCGGGCGGCGCTCGCTCCGG - Intergenic
901109834 1:6785642-6785664 ATCCCGGGCATCGGCGGCGCCGG + Intronic
901361368 1:8703436-8703458 TTGCCGGCCGCCGCCGTCGCGGG - Intronic
901451353 1:9338525-9338547 CTCCTGGGCGAGGCCGGAGCTGG - Intronic
901800691 1:11706426-11706448 TGCCCGGGCCCCGCCGGCGGTGG - Exonic
904623319 1:31788616-31788638 GTCCCGGGCGATTCCGGCTCCGG + Intergenic
904641959 1:31937952-31937974 CTCCCGGGCGGCCCCCGCGCCGG - Intronic
905862643 1:41361507-41361529 TCACCGGGCGGCGGCGGCGCGGG + Intergenic
906365423 1:45205980-45206002 TACCGGGGCGGCCCCGGCGCCGG - Exonic
921909166 1:220528601-220528623 TACCCCGGCGGCGCCGCCGCGGG + Exonic
1067972722 10:50991327-50991349 TTCTCGGGCGGCGGCGGCGGCGG - Intergenic
1069984325 10:72273439-72273461 TGCCCGTGGGACGGCGGCGCAGG - Intergenic
1073253009 10:102133413-102133435 TTCCTGGGGGACGCCGGAGGGGG + Intronic
1075699767 10:124461812-124461834 GTCCCAACCGACGCCGGCGCCGG - Intronic
1076750094 10:132538072-132538094 TGCCCGGGCGGCGCGGGCGCTGG - Exonic
1077021074 11:417402-417424 TGCCGGGGCTACGCCGCCGCCGG - Intronic
1077037976 11:504398-504420 GTCCCGGGCGGAGCGGGCGCGGG - Intronic
1078057408 11:8019255-8019277 TCCGCGGGCGGCGGCGGCGCTGG - Intronic
1081574154 11:44309089-44309111 TCCTCGGGCGGCGCCGCCGCAGG - Intronic
1083665009 11:64269494-64269516 TACCCGGGCGGCGCTGGCCCCGG + Intergenic
1085197929 11:74683514-74683536 TGACCGGGCGGCGGCGGCGCTGG - Intergenic
1089700249 11:120240227-120240249 TTCCCGGCCGCCGCCGCCGCGGG - Intronic
1094564938 12:31590855-31590877 TTCCCGGGCGGCGGCGGCGGCGG - Exonic
1102254055 12:111406024-111406046 TTCCCCGGCGGCGGCGGCCCGGG + Exonic
1104602403 12:130162506-130162528 GTCCCGGCCGAGGCCGGCGCAGG + Exonic
1112012119 13:95301316-95301338 TTGCCGGGCGGGGCGGGCGCGGG + Exonic
1112692813 13:101916340-101916362 TTCCCGGCCCACCCCGGCCCCGG - Intronic
1113200742 13:107866175-107866197 TCCCCGGGAGACGGCGGCGGCGG - Exonic
1121645854 14:95516664-95516686 GTCCCGGGCGGCTCCGGGGCGGG + Intronic
1122436823 14:101706323-101706345 TTCCTGGGCGAGGCCGCTGCAGG + Intergenic
1122445012 14:101761776-101761798 TCCCCGGGCGGCGGCGGCGGCGG + Exonic
1122942011 14:104985709-104985731 ATCCGGGGCGAGGCCAGCGCCGG - Intergenic
1126786219 15:52179696-52179718 TTCCCGGGCGGGGACGGCGGGGG - Intronic
1127880921 15:63157756-63157778 TTCCGGGGTGGCGCCGGCCCCGG - Exonic
1128424093 15:67521716-67521738 ACCCCAGGCGAAGCCGGCGCCGG - Intronic
1132482310 16:172743-172765 GTCCCGGGCGGGGCCTGCGCGGG - Intergenic
1132483158 16:176547-176569 GTCCCGGGCGGGGCCTGCGCGGG - Intergenic
1132695911 16:1201946-1201968 GTCCCGGGCACCGCCAGCGCCGG + Exonic
1142378758 16:89720606-89720628 TTCCCGGGCGAGGACGGGGGCGG - Intronic
1203062306 16_KI270728v1_random:986852-986874 GTCCCTGGGGAGGCCGGCGCGGG + Intergenic
1148262372 17:46194101-46194123 TTCCCGGGCTGGCCCGGCGCGGG - Intronic
1148581550 17:48747438-48747460 TTCCCGCTGGACGGCGGCGCGGG - Intergenic
1149461538 17:56833692-56833714 ATCCCCGGCGGCGGCGGCGCCGG + Exonic
1149996719 17:61409640-61409662 AGGCCGGGCGGCGCCGGCGCGGG + Intergenic
1151402745 17:73866520-73866542 TTCCCGGGTGACGCTGATGCTGG - Intergenic
1151703155 17:75753902-75753924 CCCCCGGACGACGGCGGCGCGGG + Exonic
1154270196 18:12911987-12912009 TTCATGGGCGCTGCCGGCGCTGG + Intronic
1157338167 18:46756514-46756536 CTACCGGGCGCCGCGGGCGCGGG + Exonic
1157362826 18:47034693-47034715 TTCCCGGGCGCAGCGGGCTCAGG + Exonic
1158602113 18:58864069-58864091 TGCCCGGCCGGCGCCGGCGGGGG - Intronic
1158976693 18:62716438-62716460 CTCCCGGGCGGCGGCGGCTCCGG - Exonic
1160821737 19:1062162-1062184 TTCCCGGGCCACGCTGGGGATGG - Exonic
1161813024 19:6481619-6481641 TTCCCGGGCCAGGCCTGAGCCGG - Intronic
1162935338 19:13979013-13979035 TCCCCGGCCCACGCCGCCGCCGG - Intronic
1163435814 19:17294486-17294508 TTGGCGGGCGAAGCCGGCCCTGG + Exonic
1163708630 19:18832390-18832412 GGCCCGGGCGGCGCGGGCGCGGG + Exonic
1164834862 19:31350154-31350176 TCCCCGGGGGACGCCAGCCCCGG - Intergenic
1166882993 19:45940332-45940354 TACGCGGGCGAGGCCGGGGCCGG - Exonic
1167466174 19:49652019-49652041 TCCCAGGGCGAGGCCGGGGCGGG - Exonic
933751197 2:85602822-85602844 TTCCCCCGTGACGCGGGCGCGGG - Intronic
937308605 2:120887478-120887500 TTCCCGGGCTTCGCCAGCGCGGG - Intronic
942453585 2:176123144-176123166 TTCCCGGGCGGTGCGGGCGGTGG + Exonic
949000478 2:241610265-241610287 TTCCGGGGCGGGGCCGGCGGAGG - Intronic
1169116870 20:3071842-3071864 TTCTCAGGCGAGGCCGGAGCGGG - Intronic
1174330406 20:49812962-49812984 TTCCCGGGCGGCGGAGGCGGCGG + Intronic
1183966651 22:41446474-41446496 TTCCCGGGCGTCGCCGGGCCAGG + Exonic
1185281316 22:49971287-49971309 TTCCTGGGCGCCGACGACGCAGG + Intergenic
950618081 3:14178421-14178443 TTCGCGGGAGACGCCGCCGGTGG - Exonic
952383465 3:32821779-32821801 GTCCCGGGAGAGGCGGGCGCAGG + Intronic
952942293 3:38454071-38454093 CTCCGGGGCGACGCGGGGGCCGG - Exonic
953705339 3:45226240-45226262 TTCCCCGCCGCCCCCGGCGCCGG + Exonic
954912823 3:54122843-54122865 TCCCCGGGCGGCGCAGGAGCCGG - Intronic
960602175 3:119469174-119469196 TTCCCGGGAGCCGGCCGCGCGGG - Intronic
984928256 4:184825651-184825673 GTCGCGGGCGGCGCGGGCGCGGG - Intronic
985895485 5:2748313-2748335 CTCCCGGGCGCCGCCGGCCGCGG + Intronic
989571617 5:42951181-42951203 TTACCGGGCGGCGGCGGCGCTGG - Intergenic
989584815 5:43066509-43066531 TTCCCGGGCGACGCCGGCGCTGG - Intronic
992939755 5:81750790-81750812 TTCCCGGGAGGTGCGGGCGCTGG - Intronic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002632685 5:180591545-180591567 AGCGCGGGCGAGGCCGGCGCTGG - Intergenic
1008013380 6:46491416-46491438 GTCCCGGGTGACGGCGGCGGAGG - Intronic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1011610436 6:89145971-89145993 TTCCCGCGCGGCGCCGGGGGCGG + Intergenic
1013117469 6:107114442-107114464 CTCCCGGCCGCCGCCGCCGCGGG + Intronic
1020130649 7:5556768-5556790 CTCCCGGAAGACGCCGGCGAGGG + Intronic
1023752963 7:43389251-43389273 TTCCCAGGTGACGCTGACGCTGG - Intronic
1038543924 8:28411693-28411715 TTCCCGGCGGCGGCCGGCGCGGG - Intronic
1039858359 8:41435530-41435552 TTCCAGGGCCAGGCCGGCTCAGG + Intergenic
1043173862 8:77000104-77000126 TTCCGGAGCGACGCAGGAGCCGG + Exonic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1043502958 8:80874325-80874347 CTCCCGGGCGGCGGCGGCGGCGG - Intronic
1045023538 8:98064619-98064641 TTCCGGGCCGACACCCGCGCAGG + Exonic
1049585085 8:143429307-143429329 GTCCCCGGCGACGGCGGCGCGGG + Exonic
1049828374 8:144685007-144685029 TTCCCGGGCGCCGTCGGAGTGGG - Intergenic
1052048335 9:23820820-23820842 CTGCCGGGCGAGGCCGGCTCTGG - Intronic
1058937189 9:109780222-109780244 CTCCCGGTCGCCGCCGCCGCCGG - Intronic
1061489816 9:130938729-130938751 CTCCCGGGCCGCCCCGGCGCGGG - Exonic
1189695075 X:43655089-43655111 TTCCCCGGCGGCACCGGCACCGG + Intronic