ID: 989585481

View in Genome Browser
Species Human (GRCh38)
Location 5:43071243-43071265
Sequence TGCTCTGGCCTACAGCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 315}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989585481_989585486 22 Left 989585481 5:43071243-43071265 CCCTGGAGCTGTAGGCCAGAGCA 0: 1
1: 1
2: 1
3: 35
4: 315
Right 989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG 0: 1
1: 0
2: 0
3: 10
4: 106
989585481_989585487 23 Left 989585481 5:43071243-43071265 CCCTGGAGCTGTAGGCCAGAGCA 0: 1
1: 1
2: 1
3: 35
4: 315
Right 989585487 5:43071289-43071311 TTAACACGCTGACATCTTTCGGG 0: 1
1: 0
2: 0
3: 10
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989585481 Original CRISPR TGCTCTGGCCTACAGCTCCA GGG (reversed) Intronic
902760452 1:18577384-18577406 TGTCCTGCCCTCCAGCTCCATGG + Intergenic
903121261 1:21218302-21218324 AGCTCTGGCCGGCAGGTCCATGG - Intronic
904082167 1:27879197-27879219 GGCTCTGGCCAGCAGCTCCTGGG + Intronic
905753912 1:40490502-40490524 TGCTCTTTCCTCCAACTCCAGGG - Intronic
906139050 1:43522576-43522598 TGCTCTGGCAGACAGCAACAGGG + Intergenic
906586648 1:46984436-46984458 AGCTCTGTCCTGCAGCTCCCTGG + Intergenic
907453115 1:54559939-54559961 TGCTCTGTCCTGTGGCTCCAGGG + Intronic
908771067 1:67596264-67596286 TGCTGTAGCCTACTGCTCCTAGG + Intergenic
910000041 1:82330804-82330826 TGCTCCGGCCTGCAGCTCCGGGG + Intergenic
910907047 1:92192291-92192313 TGCTTCGGGCTCCAGCTCCACGG + Intergenic
912463157 1:109851091-109851113 AGCTCTGGTCTGCAGCTCCCAGG + Intergenic
912881694 1:113422829-113422851 AGCTCTGGCTTGCAGCTCCTGGG + Intronic
914875561 1:151511089-151511111 TGCTCTGGCCGACGGCTCCCGGG + Intronic
916469580 1:165109656-165109678 AGCTCTGGTCTACAGGTCCCAGG - Intergenic
917495972 1:175540544-175540566 AGCCCTGGCCTACAGCTAGATGG + Intronic
919331721 1:196180869-196180891 AGCTCTGCACTCCAGCTCCATGG - Intergenic
920637048 1:207713865-207713887 CGCTCAGGCCTGCATCTCCAAGG + Intronic
920841989 1:209562869-209562891 TGCTCTGGGCTCCAACTCCACGG - Intergenic
921650725 1:217674748-217674770 TGCTCTGGCCTGTGGCTCCAGGG + Intronic
923329717 1:232911377-232911399 AGCTCTGGCCTGCAGTTCCCCGG + Intergenic
923865614 1:237935998-237936020 TGCTCTGTCCTATATGTCCACGG - Intergenic
1062980578 10:1718776-1718798 GGCTCTGGCTTCCAGCTCCCAGG + Intronic
1063089652 10:2850951-2850973 TTCTCTGGTCCACAGATCCAGGG - Intergenic
1063339944 10:5253598-5253620 TGCTCTGGGCTACCTCTCCCAGG - Intergenic
1063343794 10:5293053-5293075 TGCTCTGGGCTACCTCTCCCAGG + Intergenic
1065150206 10:22815057-22815079 TGCTCTGGCCTATAAGTTCAAGG + Intergenic
1065304448 10:24355161-24355183 TCCTCTGGCCCCAAGCTCCAGGG - Intronic
1065683351 10:28259766-28259788 CGCTCTGGCCTAGAACTCCTGGG - Intronic
1066583447 10:36906015-36906037 TGGTCTGGCCTATTGCTCCTAGG - Intergenic
1066676848 10:37897001-37897023 AGCTCCGGTCTACAGCTCCCAGG + Intergenic
1067258611 10:44666689-44666711 TGCTCTGGCCTGTGGCTCCTGGG + Intergenic
1067450576 10:46379725-46379747 TGCTCTGCCCTTCAGCCCCTTGG - Intronic
1067586667 10:47480026-47480048 TGCTCTGCCCTTCAGCCCCTTGG + Intronic
1067716811 10:48696503-48696525 TGCTCAGGCCCACATCTCTACGG + Intronic
1067878738 10:50025741-50025763 TGCTCTGCCACACTGCTCCAGGG + Intergenic
1068287789 10:54962337-54962359 TGCTCTGGCCCACAGTTCCTGGG - Intronic
1069153270 10:64992832-64992854 TGATATGGCCTACTGCTCCTAGG - Intergenic
1070735952 10:78863835-78863857 TGCCCTGGTCTCCAGCTCCAAGG + Intergenic
1071057054 10:81524143-81524165 TACTGTGGCCTTCAGCTTCATGG - Intergenic
1071563144 10:86658401-86658423 TGCTCTGGCCTTCACCTCACAGG - Intronic
1072555144 10:96509095-96509117 TGTTCTGGCCAACAGGTCCCAGG + Intronic
1072709682 10:97707810-97707832 CCCCCTGCCCTACAGCTCCAGGG + Intergenic
1073346512 10:102786938-102786960 GGCTCTGGACTCCAGCTCCCTGG - Intronic
1074163107 10:110850385-110850407 TCCACTGTCATACAGCTCCAGGG + Intergenic
1075020742 10:118950324-118950346 TCCTCTGGCCCACAGCCCAAAGG + Intergenic
1075343480 10:121665261-121665283 TGCTCTGGACTCCAGCTCCCTGG + Intergenic
1076994346 11:290860-290882 TCCCCTGGCCTGCAGCTGCAGGG - Exonic
1077273795 11:1693999-1694021 TGCTCTGAGCTACAGCCCCGAGG + Intergenic
1077443319 11:2578687-2578709 AGCTCAGCCCCACAGCTCCAAGG - Intronic
1078451318 11:11443009-11443031 GGCTCTGGTCTCAAGCTCCAGGG - Intronic
1079141468 11:17813001-17813023 TGCTCTTCCCTACTGTTCCATGG + Intronic
1080736581 11:35022003-35022025 AGCTGTGGTCTACAGCTCCCAGG + Intergenic
1081152738 11:39652202-39652224 CGCTCTGGCCTACAACTCCTGGG + Intergenic
1081508699 11:43745593-43745615 TGGTATGGCCTAAAGCTCCTAGG + Intronic
1081906385 11:46672992-46673014 TGCTCAGGTCCTCAGCTCCATGG + Intronic
1082748635 11:56995240-56995262 TGCTTTGGTCTCCAGCCCCATGG + Intergenic
1083356107 11:62067469-62067491 TGTTCCTGCCTGCAGCTCCAGGG + Intergenic
1083815973 11:65132665-65132687 TGCTCTGGAGTACAGGTCCACGG + Intronic
1084644300 11:70445740-70445762 TGCCCTGGCCACCAGCTCCTAGG - Intergenic
1084860414 11:72014419-72014441 TGCTCTGGCCGCCTTCTCCAGGG + Exonic
1085519395 11:77129322-77129344 TGCTGTGTCCCAGAGCTCCAGGG + Intronic
1085903794 11:80735158-80735180 TGGTCTGGCCTATTGCTCCTAGG + Intergenic
1086086137 11:82956798-82956820 AGCTCTGGTCTGCAGCTCCCAGG - Intronic
1086644933 11:89208993-89209015 AGCTCTGGTCTACATCTCCCAGG + Intronic
1087229782 11:95647476-95647498 TGCTCTGGCATTCAGGACCATGG - Intergenic
1087391243 11:97537621-97537643 TGCTCTGGCCCATGGCTCCCAGG - Intergenic
1087728508 11:101751795-101751817 TTCTCTGGGCTGCAGCTTCAAGG - Intronic
1090443704 11:126745696-126745718 AGCTCTCACCTACAGCACCAAGG - Intronic
1091160311 11:133413891-133413913 TGCTGGGTCCCACAGCTCCAGGG - Intronic
1091534414 12:1391905-1391927 TGCTGTGACCTGCAGCTCCCTGG - Intronic
1093601543 12:21031193-21031215 AGCTCTGGCATACAATTCCAGGG + Intronic
1093691651 12:22115918-22115940 TGCTGTGGGCTCCAGCCCCATGG + Intronic
1094061191 12:26316718-26316740 AGCTCTGGTCTGCAGCTCCCAGG - Intergenic
1094551563 12:31456649-31456671 TGCTCCGGCCTACAGTTTTAGGG - Intronic
1095260294 12:40091043-40091065 TGCTATAGCCTACTGCTCCTAGG + Intronic
1096371189 12:51070410-51070432 TGCTCCTGTCTACATCTCCAGGG + Intronic
1096769441 12:53925231-53925253 GGGTCTGGCCTACATATCCAGGG + Intergenic
1099534028 12:83823806-83823828 TGCTCTGGCCTGCAGCTCCATGG + Intergenic
1100820328 12:98423549-98423571 TGCTGTGGCCTATGGGTCCAGGG + Intergenic
1101414593 12:104498240-104498262 TGTTCTGTCCTACAGCTCCAGGG + Intronic
1101628678 12:106471554-106471576 GGCTCTGGTCTATAGCTCCCAGG - Intronic
1101772569 12:107764909-107764931 TGGTATGGCCTATAGCTCCTAGG + Intergenic
1102295590 12:111734010-111734032 TGATGTGGCCTACAGCTGCCTGG + Exonic
1102323076 12:111955862-111955884 TGGTATAGCCTACAGCTCCTAGG - Intronic
1102592804 12:113969706-113969728 TACTCTGCCCTTCAGCCCCAGGG - Intergenic
1103198794 12:119069449-119069471 TGCTGTGGCCTCCAGCTGCTAGG - Intronic
1104150419 12:126076774-126076796 TTTTCTGGCTTACAGCTCCCAGG - Intergenic
1104417513 12:128607377-128607399 TTCTCCGGCCTAAACCTCCAAGG - Intronic
1104757413 12:131277843-131277865 TGCTCTGCCCCACGGCTGCAGGG + Intergenic
1105045685 12:133001525-133001547 GGCTCTGCCCTGCAGTTCCATGG + Intronic
1105588387 13:21766654-21766676 TGGTCTAGCCTACTGCTCCTAGG + Intergenic
1106177136 13:27341191-27341213 TGGTCTGGCCTATTGCTCCTAGG + Intergenic
1106848273 13:33761209-33761231 TCCTCTGGCCTCCAGTTACAGGG + Intergenic
1107985163 13:45769513-45769535 TGCTTTGGCCTCCAGCTCTCTGG + Intergenic
1108826285 13:54416239-54416261 TGCTATGGCCTGTGGCTCCAGGG + Intergenic
1109801189 13:67380494-67380516 CGCTCTGGCCTCCAGCCCCGTGG - Intergenic
1111073446 13:83200327-83200349 TGCTTTGGGCTCCAGCTCAATGG - Intergenic
1113426784 13:110214667-110214689 TTCTCTGGCCTTCAGATTCAGGG + Intronic
1114210113 14:20606909-20606931 TGCTGTGGCCTATGGGTCCAGGG + Intronic
1115747445 14:36451954-36451976 TGCTTTGTCCTACCGCTCCCAGG - Intergenic
1116209273 14:41911651-41911673 AGCTCCGGTCTACAGCTCCCAGG - Intergenic
1116418941 14:44711051-44711073 AGCTCCGGTCTACAGCTCCCAGG - Intergenic
1116778276 14:49206652-49206674 TGCTGTGGCCTAGAGATCAAGGG - Intergenic
1117089671 14:52237299-52237321 TACTGTGGCCTTCAGCTTCATGG - Intergenic
1120470611 14:84919058-84919080 TGCTCAGACCCACAACTCCAGGG + Intergenic
1120624984 14:86813885-86813907 AGCTCTGGTCTGCAGCTCCCAGG - Intergenic
1121422269 14:93824294-93824316 AGCCCTGGCCCACAGTTCCATGG + Intergenic
1125930193 15:43594476-43594498 TGCACAGCCCTCCAGCTCCAGGG - Intronic
1125943361 15:43694308-43694330 TGCACAGCCCTCCAGCTCCAGGG - Intronic
1126137496 15:45405742-45405764 TGCTCTGGGCTTCAGCACTAGGG - Intronic
1126489255 15:49218498-49218520 TGCTCTTTCCTACTGCTCCTGGG - Intronic
1126933782 15:53684228-53684250 AGCTCCGGTCTACAGCTCCCAGG + Intronic
1127755332 15:62086354-62086376 GGTTCTGGACTCCAGCTCCAGGG + Intergenic
1127972632 15:63973386-63973408 TGCTCTGCCCTCCAGGCCCATGG - Intronic
1128310381 15:66627956-66627978 TGGTCTGGCCTACTGCTCCCAGG - Intronic
1128494528 15:68186822-68186844 TGGTCTGGCCTACTGCTCCCAGG - Intronic
1128983051 15:72200236-72200258 TGCTCAGCCCTACAACTCAAAGG + Intronic
1129464550 15:75716592-75716614 TTTTCTGGCCAAGAGCTCCATGG + Intergenic
1129720697 15:77876420-77876442 TTTTCTGGCCAAGAGCTCCATGG - Intergenic
1129982624 15:79888165-79888187 TTCTCTGGCCAACAGCTGCTTGG - Intronic
1130171861 15:81523209-81523231 TGCTTTGGGCTCCAGCCCCACGG + Intergenic
1131459585 15:92608886-92608908 GGCTGTGGCCTACACCTCCAGGG + Intergenic
1132880834 16:2161064-2161086 TTCCCTGGCCTCCAGCCCCAGGG + Intronic
1132895875 16:2229171-2229193 GCCTCTGGCCCACACCTCCAGGG + Intronic
1138332246 16:56224431-56224453 TGCTCTGACCTAAGGCTGCATGG + Intronic
1138998323 16:62478739-62478761 TGCTCCAGCCTGCAGCTCCTGGG - Intergenic
1139431896 16:66915220-66915242 GGCTCTGGCCCTCAGCCCCAAGG - Exonic
1139466687 16:67157822-67157844 TGCACTGACCTACAGCTCAATGG + Intronic
1142733284 17:1877734-1877756 TGCTGTGTCCCAAAGCTCCACGG - Intronic
1143470742 17:7173816-7173838 TGCTCCGGCCTCCAGTTCCTGGG + Exonic
1143510258 17:7391575-7391597 TGCACTGTCCTACAGCTCTGGGG + Intronic
1144434222 17:15224514-15224536 TTCTCTGGTCTGCAGCTCCCAGG - Intergenic
1145043299 17:19592762-19592784 CGCTCTGGCATACAGAGCCAGGG - Intergenic
1145834228 17:27941803-27941825 TGCTCAGGCCTGCAGGACCAGGG - Intergenic
1146239988 17:31211606-31211628 TGGTCTAGCCTACTGCTCCTAGG + Intronic
1146527739 17:33581293-33581315 TGCTCAGTCCTACAGCTGCATGG + Intronic
1146746440 17:35334337-35334359 AGCTCTGGTCTGCAGCTCCCAGG - Intergenic
1148063181 17:44850567-44850589 TGCTCTGGCCCCCTACTCCAGGG + Exonic
1148158396 17:45436401-45436423 TGCACAGGCATCCAGCTCCAAGG + Exonic
1148204053 17:45768526-45768548 TGCTCTGCCCTCCAGCACCAGGG - Intergenic
1149482621 17:57016159-57016181 TGGTCTGGCCTGCAGCAACAAGG - Intergenic
1150737217 17:67751208-67751230 TGCTCTGGCCCAAGGCTCCAGGG - Intergenic
1150936044 17:69636845-69636867 TTCTCTGTCCTACAGCAGCAAGG - Intergenic
1151318578 17:73338796-73338818 GGCACAGGCCTACAGCTACACGG - Exonic
1151997711 17:77620772-77620794 TTCTCTTCCCTCCAGCTCCATGG + Intergenic
1153492068 18:5659817-5659839 TGCCCTTGCCTACAGCTCCCTGG + Intergenic
1155333166 18:24738307-24738329 TGCTTTCTCCTCCAGCTCCAGGG - Intergenic
1155721820 18:29023605-29023627 GGCTATAGCCTACTGCTCCAGGG + Intergenic
1155917432 18:31570210-31570232 TTCTCTGGGTTAAAGCTCCATGG + Intergenic
1155986576 18:32236656-32236678 TGCTATGGCCATCAGCTCCTGGG - Intronic
1156372091 18:36480488-36480510 GGCTCTTGCCTACACCTTCAAGG + Intronic
1156752271 18:40473679-40473701 TGCCTTGGCTTACAGCTTCATGG - Intergenic
1158012829 18:52748543-52748565 TACTCTGGCCCACAGCTCTTGGG + Intronic
1161099900 19:2416395-2416417 TCCTCTGACCTTCGGCTCCAGGG - Intronic
1161845769 19:6711118-6711140 GGCTCTGCCCTACAGCACCGTGG - Exonic
1163091181 19:15021506-15021528 TGCGCTCACCTTCAGCTCCAAGG - Exonic
1165507811 19:36245544-36245566 TGCTCTGGACTACATTTCCCAGG + Intronic
1165872192 19:38980889-38980911 CACTCTGGCCTGTAGCTCCAGGG - Intergenic
1167246448 19:48375943-48375965 TGCTTTGGCCTAGGGCTCCTGGG + Intronic
1167354698 19:48996094-48996116 TGCTGTGGCCTCCACCTCCCAGG - Intronic
1168113002 19:54205245-54205267 TGCCCTTGCCCACAGCCCCAGGG - Intronic
927297347 2:21469848-21469870 TGCTCTTTCCTCCAGCCCCATGG + Intergenic
931030676 2:58171647-58171669 AGCTCCGGTCTACAGCTCCCAGG + Intronic
931566326 2:63619750-63619772 AGCTCTGGTCTGCAGCTCCCAGG + Intronic
932444574 2:71768377-71768399 TGGTATGGCCTACTGCTCCTAGG + Intergenic
932888020 2:75564473-75564495 TGCTCTGACCACCAGCGCCATGG - Intronic
934560879 2:95312747-95312769 GGCTCGGGCCCAGAGCTCCACGG + Intronic
935224380 2:101040367-101040389 TGCTCTGGCTTCCAGGTCCCTGG + Exonic
937075921 2:119106488-119106510 GGCTCAGGCCTTCAGCACCACGG - Intergenic
938788863 2:134659079-134659101 TGGTATGGCCTACTGCTCCTAGG + Intronic
939928357 2:148201495-148201517 TGCTCTAGCCTGCACCTCCAGGG + Intronic
940411546 2:153369870-153369892 TGTCCTGGCCAACAGCTCAATGG + Intergenic
941157990 2:162002123-162002145 TTCTAAGGCCTACACCTCCAGGG - Intronic
941184856 2:162309185-162309207 TGCTCTGCCTTCCAGGTCCACGG + Intronic
942564615 2:177254160-177254182 TTCTCGGACCTACAGCTGCAAGG - Intronic
943402808 2:187436711-187436733 TGCTTTGGCCTACATGGCCATGG - Intronic
944080996 2:195788164-195788186 TGCTATTGCCTACAGCTCTCTGG - Intronic
944406275 2:199387306-199387328 TGCTCTGGCCCTCCTCTCCAGGG - Intronic
944764242 2:202848866-202848888 AGCTCTGGTCTGCAGCTCCCAGG + Intronic
945489637 2:210440083-210440105 TGCTCTGCCCTACAGTTCTTGGG - Intronic
946097941 2:217291700-217291722 TGCTTTGGGCTTCAGCCCCATGG + Intronic
947073475 2:226317121-226317143 TGTCCTGGCCTCCTGCTCCAGGG + Intergenic
947939025 2:234032795-234032817 TGCTCTGGCCTGGAGCTCATTGG - Intergenic
1170273432 20:14554521-14554543 TGTTTTGGCCTACAGAGCCATGG - Intronic
1170812018 20:19681466-19681488 TTCTCTGGGCCACATCTCCAGGG - Intronic
1171255893 20:23688897-23688919 GGCTCTGGCCTCGAGCTCCAAGG - Exonic
1171322608 20:24259547-24259569 TGCTCGGGCCTGCATGTCCAGGG + Intergenic
1172186566 20:33034748-33034770 TGCTCTGTCCTCCAGCTTCATGG + Exonic
1173221532 20:41136692-41136714 TGGTCTGACCTGCAGCTCCCAGG - Intergenic
1173402682 20:42739196-42739218 AGCCATGGCCAACAGCTCCATGG + Intronic
1176734774 21:10535834-10535856 GACTCAGGCCTACAGCTACATGG + Intronic
1177773164 21:25539511-25539533 TGCTCTGGCCCAGGGTTCCAGGG - Intergenic
1179505173 21:41835348-41835370 TACTTTGGCCTAAAGTTCCACGG + Intronic
1179594111 21:42430751-42430773 TGCTGTGGACTGCAGCTTCATGG + Intronic
1179658758 21:42861543-42861565 TTCTCTGGCCTGCAGCCCCCCGG - Intronic
1180562507 22:16631314-16631336 GACTCAGGCCTACAGCTACATGG + Intergenic
1180839898 22:18954410-18954432 TGCCTTGGCCAGCAGCTCCAAGG - Intergenic
1181119236 22:20654467-20654489 TGCTCTGCCATGCTGCTCCAGGG - Intergenic
1181967698 22:26668380-26668402 GGCTCTGGAGGACAGCTCCAGGG + Intergenic
1182254582 22:29029152-29029174 TGCTCTGGCAAGGAGCTCCAAGG + Intronic
1182532259 22:30969445-30969467 TGCTCTGGCATCCAGCTCTTGGG + Intergenic
1182534720 22:30992210-30992232 CCCTCTGTCCCACAGCTCCAAGG + Intergenic
1183214141 22:36468218-36468240 AGCCCTGGCCTGCAGCTGCAAGG - Intronic
1183720783 22:39560218-39560240 TGCTCTGGGCCTCAGCCCCAAGG + Intergenic
1184368022 22:44064776-44064798 TGCTGTGGCCTCCACCTCCCGGG - Intronic
1184402076 22:44280138-44280160 TGCTCTGCCCCACATCTCCCTGG - Intronic
1185126977 22:49016778-49016800 GGCTCGGGCCCACATCTCCAGGG + Intergenic
949829533 3:8199075-8199097 TGCTCTGGTCTCCTCCTCCAAGG + Intergenic
949838033 3:8290562-8290584 TGCTCTGGGATAGGGCTCCAGGG + Intergenic
950259866 3:11536017-11536039 TGCTGGGGCCTCCATCTCCATGG + Intronic
950385628 3:12657103-12657125 TGCACTGGCCTGCACCTACAGGG + Intronic
950669067 3:14514367-14514389 GGCTTTGGCCTCCAGCTCCAGGG - Exonic
950922292 3:16706863-16706885 TGCTCTCACCTACAGCTCTTAGG - Intergenic
951653778 3:24981874-24981896 AGCTCTGGTCTACAGCTCCCAGG - Intergenic
953223344 3:40994595-40994617 TGGTCTAGCCTATAGCTCCTAGG + Intergenic
953889093 3:46737184-46737206 TGCCCTGGTCTCAAGCTCCAGGG + Intronic
954401133 3:50320409-50320431 TGCTGTGGGCTTGAGCTCCATGG + Exonic
955454072 3:59100921-59100943 TGCTCTGGTCTCTAGCTCCCAGG - Intergenic
957206434 3:77205016-77205038 TGCTCTGGGCTGCAGCCCCGTGG + Intronic
957344507 3:78944558-78944580 AGCTCCGGTCTACAGCTCCCAGG + Intronic
959162988 3:102741779-102741801 TGCTATGGCCTATGGGTCCAGGG + Intergenic
959417420 3:106092792-106092814 AGCTATGGCCTACTGCTCCTAGG + Intergenic
961934757 3:130571274-130571296 TGCCATGGCTAACAGCTCCACGG - Exonic
963676599 3:148319263-148319285 GGCTCTGGCCAATAGCTGCAAGG - Intergenic
963683574 3:148410622-148410644 TGCTCTGGCTTAAAGGGCCAAGG - Intergenic
963983404 3:151565448-151565470 TGCTCTGGCCAGGAGCTCCCAGG - Intergenic
968786531 4:2626122-2626144 TGACCTGGCCTTCACCTCCAAGG - Intronic
968792314 4:2674787-2674809 TGCTCTGGTCTTGAGCTCCCAGG - Intronic
968816998 4:2827455-2827477 GGCTCTGGCCTTCAGCGGCAGGG + Intronic
969356616 4:6631356-6631378 TACTGTGGCCTTCAGCTTCATGG - Intergenic
970084797 4:12334591-12334613 AGCTCTGGTCTACAGCTCCCCGG + Intergenic
970784566 4:19780484-19780506 AGCTCTGGTCTGCAGCTCCCAGG - Intergenic
971860091 4:32090749-32090771 TGCTCCAGCCTGCAGCTCCTGGG + Intergenic
973277785 4:48327731-48327753 TGCTTTGGGCTCCAGCTCCATGG - Intergenic
973591431 4:52446354-52446376 AGCTCCGGTCTACAGCTCCCAGG + Intergenic
974402398 4:61424400-61424422 TGCTGTGGCCTATGGGTCCAGGG - Intronic
975528680 4:75378256-75378278 AGCTCTGGTCTGCAGCTCCCAGG + Intergenic
976630896 4:87235386-87235408 TGGTCTAGCCTACTGCTCCTAGG - Intronic
976712515 4:88087486-88087508 TGCTCTGGGTTACAGATCCTTGG + Intergenic
976811966 4:89108115-89108137 TGCTGTGGCCTATAGGTCCAGGG + Intronic
977230641 4:94448361-94448383 TGCTATGGCTTACACCTCTATGG + Intergenic
978089206 4:104692848-104692870 AGCTCCGGTCTACAGCTCCCAGG - Intergenic
978617631 4:110612233-110612255 AGCTCTGGGCTACAGCTTCCCGG - Intergenic
980282364 4:130737688-130737710 CACTCTGGCCCACAGCTCCTTGG - Intergenic
980873484 4:138636786-138636808 TGCTCTGTTCTGCAGCTGCAAGG - Intergenic
981675488 4:147338582-147338604 TGCTCTTGCATCCAGCTTCAGGG - Intergenic
983340091 4:166449629-166449651 AGCTCCGGTCTACAGCTCCCAGG - Intergenic
983352020 4:166602213-166602235 TGCTCTGGCCCACGGCTCTGGGG - Intergenic
984339352 4:178435436-178435458 TGGTCTGGCCTTCAGTTTCAAGG + Intergenic
986177671 5:5365598-5365620 GGCTCTAGCCTACTTCTCCAAGG - Intergenic
986210547 5:5667516-5667538 TGCCCTAGCCTTCAGCACCATGG - Intergenic
986401227 5:7383765-7383787 TGCTCTGGCCAATGGCTACAGGG + Intergenic
986758622 5:10859905-10859927 TGCTCTGACCCACGGCCCCAGGG + Intergenic
987348520 5:16999942-16999964 TGCTCTGTCACCCAGCTCCAGGG - Intergenic
988043092 5:25912502-25912524 CTCTCTGGTTTACAGCTCCAAGG - Intergenic
988853796 5:35205833-35205855 TGTCCTGGCCTACAGCTGGAGGG - Intronic
989585481 5:43071243-43071265 TGCTCTGGCCTACAGCTCCAGGG - Intronic
990471136 5:56116752-56116774 TGCACTGGGCTGCAGCTGCAGGG - Exonic
990707168 5:58542239-58542261 AGCTCCGGTCTACAGCTCCCAGG - Exonic
990897700 5:60716346-60716368 AGCTCTGGTCTGCAGCTCCCAGG - Intergenic
991239154 5:64437586-64437608 TACTGTGGCCTTCAGCTTCATGG - Intergenic
994029754 5:95128162-95128184 TGCACTTGTCTAAAGCTCCATGG + Intronic
994762782 5:103877978-103878000 TGGTCTGGGCTCCAGCCCCACGG + Intergenic
994950407 5:106454251-106454273 TGTTCTGTCCTATAGCTTCAAGG - Intergenic
995548690 5:113257989-113258011 TGCTCTGGCCTCCTGCTTTATGG - Intronic
996176841 5:120369148-120369170 TGCTCTGGCCAGCAGCACCTGGG - Intergenic
996217453 5:120887054-120887076 CACTCTGGCCCACAGCTCCTGGG + Intergenic
996303545 5:122018461-122018483 TGCTCAGGCCTAAAACTCTAAGG - Intronic
996596565 5:125209898-125209920 TGCTTTGGGCTACAGTTGCAGGG + Intergenic
997305969 5:132836648-132836670 TGCTGTGGCCAACAGCTCCTGGG + Intergenic
997474480 5:134134616-134134638 TCCTCTGTCCTAAAGTTCCAGGG - Intronic
1001214319 5:169841191-169841213 TCCTCTGGCCTACAGTCACATGG + Intronic
1001462046 5:171924692-171924714 TGCTCTGGCCCACGGCTCCTGGG - Intronic
1002135291 5:177104001-177104023 TGCTCCTGCCTCCAGCCCCATGG + Intergenic
1002456925 5:179350575-179350597 TGCTCCTGCCAACAGTTCCAGGG + Intergenic
1002906358 6:1452366-1452388 TGGTCTGGCCAACAGCCACAAGG + Intergenic
1004753630 6:18588231-18588253 TGCTCTGCTATACAGCTCCATGG - Intergenic
1004753736 6:18589194-18589216 TGCTCTGTTATACAGCTCCATGG + Intergenic
1005321558 6:24660376-24660398 TGGTCTAGCCTACTGCTCCTAGG + Intronic
1006660621 6:35640251-35640273 TGGTTTGGCCTACTGCTCCAAGG + Intronic
1007244491 6:40450758-40450780 TTCACTGGCCTCCACCTCCAGGG + Intronic
1007472745 6:42101533-42101555 TGGACTGGCCTCCAGCTCCGTGG - Exonic
1007582206 6:42966311-42966333 CGCTCAGGCCTTCTGCTCCATGG - Exonic
1007664891 6:43508331-43508353 TGCCGTGGCCCACAGCTCCCAGG - Exonic
1007929156 6:45675349-45675371 AGCTCCGGTCTACAGCTCCCAGG - Intergenic
1011397061 6:86921196-86921218 AGCTCCGGTCTACAGCTCCCAGG + Intergenic
1014505257 6:122247473-122247495 TGCTCTGGCCTGTGGCTCCTGGG + Intergenic
1014514907 6:122366289-122366311 TGCTGTGGCCTATGGGTCCAGGG + Intergenic
1015099490 6:129459142-129459164 TGGTATAGCCTACTGCTCCAAGG + Intronic
1017288996 6:152712603-152712625 AGCTCCGGTCTACAGCTCCCAGG - Intronic
1017834095 6:158161163-158161185 TGGGCTGGCCTAGAGCTCCTGGG - Intronic
1020794738 7:12665763-12665785 TGCTCTGGGTTATAGCCCCATGG - Intergenic
1021787360 7:24165105-24165127 TGCTCTGGCCTGTGGCTCCTGGG + Intergenic
1021875792 7:25047838-25047860 AGCTCCGGTCTACAGCTCCCAGG - Intergenic
1022649910 7:32265276-32265298 TGCTCTATCCTTCGGCTCCAGGG + Intronic
1023671999 7:42586702-42586724 AGCTCTGGTCTACAGCTCCCAGG - Intergenic
1023786287 7:43711690-43711712 TGGTATGGCCTACTGCTCCTAGG + Intronic
1023835251 7:44064013-44064035 TGCTCTGGCCAACTGCCCAACGG + Intronic
1023895685 7:44431181-44431203 TGCCCAGGCCTGCAGCTGCAGGG - Intronic
1024809372 7:53189605-53189627 GGATCTGACCTACATCTCCATGG - Intergenic
1027236373 7:76300519-76300541 TGGTCTAGCCTACTGCTCCTAGG + Intergenic
1029110802 7:98212241-98212263 TGTTCTGGATTTCAGCTCCAAGG + Exonic
1029458227 7:100681679-100681701 TGCCCTGGCCTACAGCCCAGGGG + Exonic
1031196931 7:118627382-118627404 AGCTCTAGCCTGCAGCTCCTGGG - Intergenic
1031514859 7:122689060-122689082 TGCTGTGGCCTATAGGTCCAAGG - Intronic
1031915961 7:127563513-127563535 TGCTCTGGCTGAGACCTCCAGGG - Intergenic
1032500174 7:132394163-132394185 TGCTCTTGCATACAGCCCCTGGG + Intronic
1032649070 7:133857911-133857933 CACTCTGGCGTACAGCTCCCAGG + Intronic
1033884409 7:145927710-145927732 AGCTCAGTCCTACAGCTTCAAGG - Intergenic
1034215828 7:149404929-149404951 CGCTCTGGCCTGAAGCTCCTGGG + Intergenic
1036751726 8:11447732-11447754 GGCTCTGGGTTAGAGCTCCAGGG + Intronic
1037006985 8:13794182-13794204 TGCTCTCGCCTTCAGCTTGACGG + Intergenic
1037750446 8:21678798-21678820 TGTCCTGGCAAACAGCTCCAGGG - Intergenic
1037823831 8:22148756-22148778 TGCCGTGGCTGACAGCTCCAAGG - Exonic
1037966119 8:23135202-23135224 CCCTCTGGCCCACAGCTCCCAGG - Intergenic
1041004883 8:53488066-53488088 TGCTGTGGCCTATGGGTCCAAGG + Intergenic
1043929422 8:86074031-86074053 TGCTCTGGCCGACAGCCTGACGG + Intronic
1045326073 8:101118780-101118802 CCCTCTGGGCTCCAGCTCCAAGG - Intergenic
1045522510 8:102915446-102915468 TCCTCTGGGCTTCAGCTCAACGG + Intronic
1046121973 8:109858663-109858685 AGCTCCGGTCTACAGCTCCCAGG + Intergenic
1047520411 8:125591627-125591649 TGCTCTGACATACAGGTCTATGG + Intergenic
1048044656 8:130761743-130761765 TGCTCTGGCCAACTGCTGCCAGG + Intergenic
1049604889 8:143524732-143524754 GGCCCTGGCCTTCAGCTCCCCGG + Intronic
1049638008 8:143699651-143699673 TGCTCAGGCATGCGGCTCCAGGG - Intronic
1050931304 9:11330650-11330672 TGCTCTGACCCATGGCTCCAGGG + Intergenic
1050932637 9:11349389-11349411 TGCTCTGGACCATAGCTCCAAGG + Intergenic
1051474951 9:17495940-17495962 TGCTATGGCCTATTGCTCCTAGG - Intronic
1051598054 9:18845138-18845160 AGCTCCGGTCTACAGCTCCCAGG - Intronic
1052851311 9:33380174-33380196 TGCTCTCCCATTCAGCTCCAGGG - Intergenic
1053246543 9:36539058-36539080 TGCCCTGGCATACAGGTTCAAGG + Intergenic
1056579765 9:87882570-87882592 GGCTCAGGCCTAGATCTCCAAGG + Intergenic
1057275854 9:93675635-93675657 GGCTGTGGCCTACAGCTTGAGGG + Intronic
1057436938 9:95049000-95049022 TGCTCTAGACTCCGGCTCCAGGG + Intronic
1059283469 9:113153735-113153757 TTCTCTGTCCTGCAGCTCCACGG + Intronic
1060048327 9:120358676-120358698 TGGCCAGGCCTGCAGCTCCAGGG + Intergenic
1060390152 9:123269845-123269867 TGATCTGGCCTTAAGCTTCAAGG + Intergenic
1060615566 9:125010075-125010097 AGCTCCGGCCTACAGCTCCCAGG + Intronic
1062467167 9:136686567-136686589 GCCCCTGGCCTACAGCTCCGGGG - Intronic
1062674421 9:137732102-137732124 CGCCCTGGCCTGCAGCTCCCAGG + Intronic
1062696130 9:137877421-137877443 AGCTCTGGGCTGCAGCCCCAGGG + Intergenic
1190279866 X:48922501-48922523 TCTTCTGGCCTCCAGCTGCATGG - Exonic
1190321895 X:49184631-49184653 TGCCCTGGCTTCCTGCTCCACGG - Exonic
1191791486 X:64976506-64976528 AGCTCCGGACTACAGCTCCCAGG - Intronic
1191870501 X:65741155-65741177 CTCTCTGGTTTACAGCTCCAAGG - Exonic
1192280824 X:69682795-69682817 AGCTCCGGTCTACAGCTCCCAGG - Intronic
1195140001 X:101949899-101949921 AGCTCTGGTCTGCAGCTCCTAGG + Intergenic
1195249231 X:103026564-103026586 AGCTCCGGTCTACAGCTCCCAGG - Intergenic
1200331787 X:155305548-155305570 AGCTCCGGTCTACAGCTCCCAGG - Intronic
1200422628 Y:2987883-2987905 TAGGCTGGCCTTCAGCTCCAGGG + Intergenic
1202249446 Y:22854974-22854996 AGCTCCGGTCTACAGCTCCCAGG + Intergenic
1202402432 Y:24488722-24488744 AGCTCCGGTCTACAGCTCCCAGG + Intergenic
1202468348 Y:25181361-25181383 AGCTCCGGTCTACAGCTCCCAGG - Intergenic
1202592815 Y:26505375-26505397 GACTCAGGCCTACAGCTACATGG + Intergenic