ID: 989585482

View in Genome Browser
Species Human (GRCh38)
Location 5:43071244-43071266
Sequence TTGCTCTGGCCTACAGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989585482_989585487 22 Left 989585482 5:43071244-43071266 CCTGGAGCTGTAGGCCAGAGCAA 0: 1
1: 0
2: 3
3: 31
4: 257
Right 989585487 5:43071289-43071311 TTAACACGCTGACATCTTTCGGG 0: 1
1: 0
2: 0
3: 10
4: 91
989585482_989585486 21 Left 989585482 5:43071244-43071266 CCTGGAGCTGTAGGCCAGAGCAA 0: 1
1: 0
2: 3
3: 31
4: 257
Right 989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG 0: 1
1: 0
2: 0
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989585482 Original CRISPR TTGCTCTGGCCTACAGCTCC AGG (reversed) Intronic
901462428 1:9399726-9399748 CTGCTCGGGCCTCCAGCTGCAGG - Intergenic
901594079 1:10370886-10370908 TTCCTGTGGCCTCCAACTCCTGG - Intronic
902407558 1:16193643-16193665 GTGGTGTAGCCTACAGCTCCTGG - Intergenic
902571767 1:17351826-17351848 TTGCTCTGCTCTACCCCTCCAGG - Intronic
902785865 1:18732240-18732262 TTCCTTAGGCCGACAGCTCCAGG + Intronic
903161302 1:21491058-21491080 CTGCTCTGGCCCAGGGCTCCAGG - Intergenic
904082166 1:27879196-27879218 TGGCTCTGGCCAGCAGCTCCTGG + Intronic
908459791 1:64338347-64338369 ATGCCCTGGCCAACAGCACCAGG + Intergenic
910000040 1:82330803-82330825 CTGCTCCGGCCTGCAGCTCCGGG + Intergenic
910615998 1:89198834-89198856 TTGCTCTGTCCTCCTGCGCCTGG + Exonic
910694247 1:89995114-89995136 TCGCTGTGGCCTGCGGCTCCCGG + Exonic
911152519 1:94609013-94609035 TAGATCAGGCCTGCAGCTCCAGG - Intergenic
911450378 1:98054021-98054043 TTGCTCCGGCCTCCAGCCCGGGG - Intergenic
911997732 1:104788280-104788302 TTGCTCTGGCCCGCGGTTCCTGG + Intergenic
912015839 1:105034715-105034737 TTGCTGTAGCCTCAAGCTCCTGG - Intergenic
912133688 1:106633247-106633269 TTGCTCTTGGTTACAGCTACAGG + Intergenic
912881693 1:113422828-113422850 CAGCTCTGGCTTGCAGCTCCTGG + Intronic
914875560 1:151511088-151511110 ATGCTCTGGCCGACGGCTCCCGG + Intronic
915330833 1:155111461-155111483 TTCCTCTGCCCCACAGCACCTGG - Intergenic
916467300 1:165084989-165085011 CAGCTCCGGTCTACAGCTCCCGG + Intergenic
918371911 1:183869531-183869553 TCGCTCTGTCCTACAGATTCTGG + Intronic
919262746 1:195218641-195218663 TAGCTCCTGCCTGCAGCTCCCGG - Intergenic
919987942 1:202688952-202688974 TAGATGTGGCCTGCAGCTCCAGG + Intronic
921286798 1:213616371-213616393 ATCCTCTGGGCTCCAGCTCCAGG - Intergenic
921650724 1:217674747-217674769 CTGCTCTGGCCTGTGGCTCCAGG + Intronic
924468020 1:244315544-244315566 TGGCTCTGGGCTACGGCTACGGG + Intergenic
1063197339 10:3755935-3755957 TTGCGCTAGGCTACAGCTCAGGG + Intergenic
1063945230 10:11169587-11169609 CTGCTCTAGCCTATAGCTCTAGG - Intronic
1063951166 10:11224786-11224808 TTTGTGTGGCCTAAAGCTCCAGG - Intronic
1065683352 10:28259767-28259789 ACGCTCTGGCCTAGAACTCCTGG - Intronic
1066640713 10:37551793-37551815 TCACTCTGGCCTCCAGCTCTTGG + Intergenic
1067258610 10:44666688-44666710 CTGCTCTGGCCTGTGGCTCCTGG + Intergenic
1067695042 10:48528468-48528490 TTTCTGTCCCCTACAGCTCCCGG - Intronic
1068287790 10:54962338-54962360 CTGCTCTGGCCCACAGTTCCTGG - Intronic
1069893114 10:71664252-71664274 TTGCTCTGGCCAGCAGCTCTGGG - Intronic
1071230546 10:83580499-83580521 TTTCTCTGGGGTAGAGCTCCTGG - Intergenic
1073588571 10:104734348-104734370 TTGCTCTCTTCTAGAGCTCCAGG - Intronic
1074920247 10:118001131-118001153 TTGCTGCAGCCTACACCTCCTGG - Intergenic
1075092530 10:119451720-119451742 CTGCTCTGGTCTCCAGCTCAAGG - Intronic
1075843613 10:125526967-125526989 TCACTGTGGCCTACACCTCCTGG + Intergenic
1075869501 10:125759551-125759573 TTGCTGTGGCCTTGAACTCCTGG - Intronic
1076369364 10:129941682-129941704 TTTCTCTGGCCTCCAGGCCCTGG - Intronic
1076562302 10:131375179-131375201 ATGCTCTGTCCTGCAGCCCCAGG + Intergenic
1076900446 10:133335219-133335241 TTGCTCTGGGCGTCCGCTCCGGG - Intronic
1077635277 11:3837928-3837950 CTCCTCTGGCCTCTAGCTCCTGG + Intronic
1079391567 11:20026253-20026275 TGTCTCTGGACTACAGCTCTGGG - Intronic
1081095939 11:38935307-38935329 TTACTATGGTCTATAGCTCCTGG - Intergenic
1081152737 11:39652201-39652223 CCGCTCTGGCCTACAACTCCTGG + Intergenic
1084061906 11:66681200-66681222 TTGCTGTAGCCTCTAGCTCCTGG + Intergenic
1085519394 11:77129321-77129343 TTGCTGTGTCCCAGAGCTCCAGG + Intronic
1086409984 11:86535363-86535385 TTGCCCTGGCCTGCTGCTGCAGG - Intronic
1086907424 11:92433646-92433668 CAGCTCTGGTCTGCAGCTCCCGG - Intronic
1089002771 11:115065924-115065946 GTGATGTGGCCTAAAGCTCCCGG - Intergenic
1091042564 11:132295728-132295750 TGGCTCTTGCCTACATCTCTGGG - Intronic
1091802430 12:3333142-3333164 CAGCACTGGGCTACAGCTCCGGG + Intergenic
1093298098 12:17416637-17416659 TTGCTCTGGCCCATAGCTCCTGG - Intergenic
1093559732 12:20523656-20523678 TTGCTTTGGTCAACAGCTCAGGG - Intronic
1093601542 12:21031192-21031214 TAGCTCTGGCATACAATTCCAGG + Intronic
1096315722 12:50563563-50563585 TCGCTCTAGCCTCCAACTCCTGG + Intronic
1096371188 12:51070409-51070431 TTGCTCCTGTCTACATCTCCAGG + Intronic
1096406621 12:51348507-51348529 TTCCTCTGGCCTCTAGCCCCAGG + Intergenic
1096581876 12:52590937-52590959 CTGCTGTGACCTGCAGCTCCTGG + Exonic
1096714601 12:53483477-53483499 TTGCTCTCGCCTAAAGATCCAGG + Exonic
1096769440 12:53925230-53925252 TGGGTCTGGCCTACATATCCAGG + Intergenic
1098997811 12:77141906-77141928 TGGCTCTAGCCCACAGATCCTGG + Intergenic
1100274073 12:93055473-93055495 TTGCTCTGGGGTACAGTTCACGG - Intergenic
1100820327 12:98423548-98423570 TTGCTGTGGCCTATGGGTCCAGG + Intergenic
1101414592 12:104498239-104498261 TTGTTCTGTCCTACAGCTCCAGG + Intronic
1101447384 12:104747016-104747038 TTGCTTTAGCTTATAGCTCCTGG + Intronic
1102513400 12:113430648-113430670 TTGCTCTGGCCAACAGCATATGG - Intronic
1103019514 12:117522670-117522692 TTGCTCTGGCCAACAGATGTAGG + Intronic
1103637828 12:122322719-122322741 TTGCTCTGGCTTCCTGTTCCAGG + Intronic
1104238506 12:126963008-126963030 TTGCTCTGGCCAAAACTTCCAGG - Intergenic
1104757412 12:131277842-131277864 TTGCTCTGCCCCACGGCTGCAGG + Intergenic
1104889224 12:132132338-132132360 TTGGTGGGGCCTACAGCTCCTGG - Intergenic
1105211762 13:18261254-18261276 TGGCTCTGGGCTACAGCTCAGGG + Intergenic
1106481830 13:30142763-30142785 TTGCTCTGGAATTCAGCTTCAGG + Intergenic
1109423017 13:62137989-62138011 TTGCTCTGGCCCATGACTCCAGG - Intergenic
1111055103 13:82938603-82938625 TCGCTCTGGCCTGTGGCTCCTGG - Intergenic
1112029872 13:95447377-95447399 TTGCTCAGCCTTCCAGCTCCTGG + Intronic
1113741927 13:112716919-112716941 GTGCACGGGCCTCCAGCTCCCGG - Intronic
1114210112 14:20606908-20606930 TTGCTGTGGCCTATGGGTCCAGG + Intronic
1116971105 14:51067045-51067067 ATGCCCTGGTCTACAGCTCAAGG - Intronic
1120470610 14:84919057-84919079 TTGCTCAGACCCACAACTCCAGG + Intergenic
1123030682 14:105449737-105449759 TTGCTCTTGCCTGCTGCTTCTGG + Intronic
1124590705 15:31050576-31050598 TTGCTGTGGACTGCAGCCCCTGG - Exonic
1126366568 15:47900646-47900668 TTGATCAGCCCTCCAGCTCCAGG - Intergenic
1126489256 15:49218499-49218521 ATGCTCTTTCCTACTGCTCCTGG - Intronic
1127755331 15:62086353-62086375 TGGTTCTGGACTCCAGCTCCAGG + Intergenic
1128007724 15:64260661-64260683 TTACTGTAGCCTACACCTCCTGG - Intronic
1129765268 15:78161161-78161183 TTGCTCTGGCCTACAGTCTCAGG - Intronic
1131459584 15:92608885-92608907 GGGCTGTGGCCTACACCTCCAGG + Intergenic
1131696493 15:94882525-94882547 CAGCTCTGGCCCACAGCTCCTGG + Intergenic
1131830506 15:96352053-96352075 GTGTTCTAGCCTCCAGCTCCAGG - Intergenic
1131911952 15:97215865-97215887 TTGCAATGGCCTTCAGCTCCTGG + Intergenic
1132488085 16:207425-207447 TTGCTCAGGTCTAAAACTCCTGG + Intronic
1133748674 16:8707394-8707416 TTGCCCAGGTCTCCAGCTCCTGG + Intronic
1133969699 16:10558939-10558961 GTCCTCTTGCCTACAGTTCCGGG - Intronic
1136417914 16:30114570-30114592 TTGCTGAGGCCTCCAGCTTCAGG - Exonic
1137484252 16:48878383-48878405 TGGCTCTGTCCTACAGCTCATGG + Intergenic
1138998324 16:62478740-62478762 CTGCTCCAGCCTGCAGCTCCTGG - Intergenic
1139427266 16:66889883-66889905 TCACTCTGGCCTAGACCTCCTGG - Exonic
1141426838 16:83949697-83949719 TTGCTCTGAGCCTCAGCTCCTGG - Intronic
1143470741 17:7173815-7173837 CTGCTCCGGCCTCCAGTTCCTGG + Exonic
1143510257 17:7391574-7391596 CTGCACTGTCCTACAGCTCTGGG + Intronic
1144292847 17:13842995-13843017 CTGCTCAGGGCTTCAGCTCCTGG - Intergenic
1144655867 17:17036184-17036206 TTGCTCGGGCCTCCCTCTCCTGG - Intergenic
1144685529 17:17223626-17223648 TTCCTCTGGCCTTCATCTCAGGG - Intronic
1146419619 17:32671043-32671065 CCACTCTGGCCTGCAGCTCCGGG - Intronic
1147396868 17:40150295-40150317 TTGCTGTGGCCTCGACCTCCTGG - Intronic
1147645130 17:42028750-42028772 TTTCCCTGGGCTCCAGCTCCTGG + Intronic
1147767827 17:42848928-42848950 TTGCTCTTGCCCAGACCTCCTGG + Intronic
1148161377 17:45452070-45452092 TTGCTCTGGCCTTCTGCAGCAGG + Intronic
1148204054 17:45768527-45768549 ATGCTCTGCCCTCCAGCACCAGG - Intergenic
1149303815 17:55329770-55329792 TAGCTCTGGGCTCCAGTTCCAGG - Intergenic
1150392617 17:64798716-64798738 TTGCTCTGGCCTTCTGCAGCAGG + Intergenic
1150737218 17:67751209-67751231 CTGCTCTGGCCCAAGGCTCCAGG - Intergenic
1151603168 17:75119011-75119033 TTGTTCTGGCCTCAAACTCCTGG + Intronic
1152258982 17:79256385-79256407 TCACTCTGGGCTTCAGCTCCCGG - Intronic
1153141369 18:1976143-1976165 TTGCTCTGCTCTTCAGTTCCTGG - Intergenic
1155101692 18:22616958-22616980 CAGCTCTGGTCTGCAGCTCCTGG + Intergenic
1155986577 18:32236657-32236679 CTGCTATGGCCATCAGCTCCTGG - Intronic
1157067399 18:44367364-44367386 CAGCTCTGGTCTGCAGCTCCTGG - Intergenic
1158012828 18:52748542-52748564 CTACTCTGGCCCACAGCTCTTGG + Intronic
1159355908 18:67337352-67337374 CTGCTCCAGCCCACAGCTCCTGG + Intergenic
1160860171 19:1234325-1234347 TGGCTCTGTCCCACAGCCCCCGG - Exonic
1165828103 19:38717070-38717092 CTTCTGTGGCCCACAGCTCCTGG + Exonic
1166216139 19:41336457-41336479 TCACTGTGGCCTCCAGCTCCTGG + Intronic
1167246447 19:48375942-48375964 GTGCTTTGGCCTAGGGCTCCTGG + Intronic
1167406794 19:49315317-49315339 ATTCTCTGGCATACAGCTTCTGG - Intronic
1167513818 19:49911109-49911131 TTGCCCTGGTCTTCAACTCCTGG + Intronic
1167705752 19:51079915-51079937 TTGGGCTGGGCTCCAGCTCCTGG + Intronic
926095222 2:10077057-10077079 CTGCTCTGGCCAAGAACTCCTGG + Intronic
926385820 2:12334782-12334804 TTCCTCTGGGCTGCATCTCCAGG - Intergenic
928123315 2:28599394-28599416 TTGCTCAGGCCCACACCTTCTGG + Intronic
932219298 2:69987534-69987556 CTGCACTGGTCTAGAGCTCCTGG - Intergenic
933073901 2:77897861-77897883 TTGCTTTGGCCTACAGGTTAGGG + Intergenic
934301862 2:91781201-91781223 TGGCTCTGGGCTACAGCTCAGGG - Intergenic
937043583 2:118838873-118838895 TGGCCCTGGCCTGCATCTCCTGG + Intergenic
939153794 2:138501713-138501735 TTGCTCCCTCCTACAGCGCCGGG - Intergenic
939853563 2:147329695-147329717 TTTCTCTGGCCCACATCTTCAGG - Intergenic
939928356 2:148201494-148201516 CTGCTCTAGCCTGCACCTCCAGG + Intronic
940929329 2:159408245-159408267 TTGCTGTAGCCTCCAACTCCTGG + Intronic
941157991 2:162002124-162002146 TTTCTAAGGCCTACACCTCCAGG - Intronic
942522341 2:176817631-176817653 TTCTCCTGGCCTGCAGCTCCAGG + Intergenic
944003061 2:194865664-194865686 TTGCTCAGGCCTATAATTCCAGG + Intergenic
944215383 2:197249196-197249218 TTGCTCTGGCCTGGAATTCCTGG - Intronic
944257719 2:197640709-197640731 CAGCTCCGGTCTACAGCTCCCGG - Intronic
944289831 2:197992707-197992729 TTGCTCCTCCCTCCAGCTCCTGG + Intronic
945489638 2:210440084-210440106 ATGCTCTGCCCTACAGTTCTTGG - Intronic
946162166 2:217841859-217841881 CTGCTCTGGCCCCCAGCTTCTGG + Intronic
1169732647 20:8802782-8802804 TTGCTCTGACAAAGAGCTCCTGG - Intronic
1174107632 20:48174079-48174101 TTGCACTGTCCTTCAGCTCTTGG - Intergenic
1175913226 20:62414372-62414394 CTTCTCTGGCCTTCAGGTCCTGG + Exonic
1180661453 22:17470992-17471014 CTGCTTTGGAATACAGCTCCAGG - Intronic
1180814568 22:18781518-18781540 TGGCTCTGGGCTACAGCTCAGGG + Intergenic
1181200756 22:21215854-21215876 TGGCTCTGGGCTACAGCTCAGGG + Intronic
1181700986 22:24621119-24621141 TAGCTCTGGGCTACAGCTCAGGG - Intronic
1181967697 22:26668379-26668401 TGGCTCTGGAGGACAGCTCCAGG + Intergenic
1182532258 22:30969444-30969466 CTGCTCTGGCATCCAGCTCTTGG + Intergenic
1183177832 22:36237481-36237503 TTGCTGTAGCCTAGAGCCCCTGG + Intronic
1184368023 22:44064777-44064799 TTGCTGTGGCCTCCACCTCCCGG - Intronic
1203226160 22_KI270731v1_random:79581-79603 TGGCTCTGGGCTACAGCTCAGGG - Intergenic
1203264668 22_KI270734v1_random:7205-7227 TGGCTCTGGGCTACAGCTCAGGG + Intergenic
949576254 3:5341646-5341668 TTGGTTTGTCCTGCAGCTCCTGG + Intergenic
950489196 3:13292889-13292911 TTACTGTGGCCTCCACCTCCTGG - Intergenic
950669068 3:14514368-14514390 CGGCTTTGGCCTCCAGCTCCAGG - Exonic
950853280 3:16082942-16082964 TTGCTGTAGCCTCCAACTCCTGG + Intergenic
951198808 3:19855079-19855101 CAGCTCCGGTCTACAGCTCCAGG + Intergenic
951911764 3:27757914-27757936 TTACTGTGGCCTCCAACTCCTGG - Intergenic
955592431 3:60551993-60552015 TTCCTCTAGCCCACAGCCCCTGG + Intronic
956300326 3:67764888-67764910 TAGCTGTGGTCTACAGCTCCCGG - Intergenic
959162987 3:102741778-102741800 TTGCTATGGCCTATGGGTCCAGG + Intergenic
962008320 3:131370015-131370037 TGGCTCTGGCCAGCAACTCCAGG - Intergenic
962956394 3:140270832-140270854 CTGCTCTGGACTACAGGTACCGG - Intronic
968374415 4:27006-27028 CTGCTGCAGCCTACAGCTCCTGG + Intergenic
968876284 4:3269470-3269492 TGGCTCTGTCCTACTGCTCGGGG + Intronic
969637709 4:8378954-8378976 TGGCTTTGACCTGCAGCTCCTGG + Intronic
969891347 4:10262987-10263009 TTGCATTGGCCTACAGCTGATGG - Intergenic
971354785 4:25885665-25885687 TTGCTGTAGCCTTCACCTCCTGG - Intronic
971860090 4:32090748-32090770 CTGCTCCAGCCTGCAGCTCCTGG + Intergenic
972348230 4:38211616-38211638 TTCCTCTGGCCAACATCTCTTGG - Intergenic
973034303 4:45386793-45386815 TTGCTCTGGCTTAGACTTCCAGG + Intergenic
974515097 4:62897951-62897973 TTGCTGTGGCCCATGGCTCCTGG - Intergenic
975627252 4:76362264-76362286 TCACTCTGGCCTCAAGCTCCCGG + Exonic
976811965 4:89108114-89108136 CTGCTGTGGCCTATAGGTCCAGG + Intronic
977236898 4:94518911-94518933 CTTCTCTGGCCTCCAGCTCAAGG + Intronic
978546204 4:109874964-109874986 TTTCTATGGCCTGCACCTCCTGG + Intergenic
981675489 4:147338583-147338605 TTGCTCTTGCATCCAGCTTCAGG - Intergenic
983352021 4:166602214-166602236 CTGCTCTGGCCCACGGCTCTGGG - Intergenic
985460313 4:190099257-190099279 CTGCTGCAGCCTACAGCTCCTGG - Intergenic
986401226 5:7383764-7383786 TTGCTCTGGCCAATGGCTACAGG + Intergenic
986712056 5:10494857-10494879 TGGGTCTGGCCTGCAGATCCTGG - Intergenic
986744823 5:10734538-10734560 TTTCTCTGGCATCCACCTCCAGG + Intronic
986758621 5:10859904-10859926 TTGCTCTGACCCACGGCCCCAGG + Intergenic
988122831 5:26990267-26990289 TTGCTATGGTCTAGAGCTACAGG + Intronic
989282811 5:39665051-39665073 TTGCTGTGACCCACAGCTCAGGG - Intergenic
989585482 5:43071244-43071266 TTGCTCTGGCCTACAGCTCCAGG - Intronic
991550800 5:67833809-67833831 TGGCTATGGCCTTCAGCTGCAGG - Intergenic
994331904 5:98516127-98516149 TTCCTCTGGCATAGAGATCCAGG + Intergenic
995038630 5:107563648-107563670 TTAGGCTGGCCTCCAGCTCCCGG + Intronic
995321583 5:110840538-110840560 TGGCTCTGGCCCACCGCTCCTGG - Intergenic
996176842 5:120369149-120369171 CTGCTCTGGCCAGCAGCACCTGG - Intergenic
996217452 5:120887053-120887075 CCACTCTGGCCCACAGCTCCTGG + Intergenic
997305968 5:132836647-132836669 GTGCTGTGGCCAACAGCTCCTGG + Intergenic
997578945 5:135005227-135005249 TTGCTCTGGGATACAGCCCTTGG - Intronic
998617633 5:143758120-143758142 TTCCTCTGAGCTACAGCTCTGGG - Intergenic
998780255 5:145647951-145647973 CAGCTCTGGTCTACAGCTCCCGG - Intronic
999192817 5:149761416-149761438 TTCCTCTGTCCTTCAGCCCCTGG + Intronic
1000032578 5:157417532-157417554 CAGCTCTAGTCTACAGCTCCCGG + Intronic
1000940021 5:167349171-167349193 TTGCTCCCACCTTCAGCTCCGGG + Intronic
1001462047 5:171924693-171924715 CTGCTCTGGCCCACGGCTCCTGG - Intronic
1001533853 5:172484112-172484134 TGGCTGTGGGCTTCAGCTCCTGG - Intergenic
1002323032 5:178387005-178387027 TGCCTCTGGACTTCAGCTCCAGG + Intronic
1004198529 6:13527110-13527132 TGGCTTTGTCCCACAGCTCCTGG - Intergenic
1006458624 6:34145438-34145460 TGGGTCTGGCCGAGAGCTCCGGG + Intronic
1006544999 6:34773430-34773452 TTGTTTTGTCCTGCAGCTCCTGG + Exonic
1007244490 6:40450757-40450779 TTTCACTGGCCTCCACCTCCAGG + Intronic
1007723382 6:43899511-43899533 TTACTCTGACTTTCAGCTCCCGG + Intergenic
1009306909 6:62102607-62102629 TGACTCTGGCCCACGGCTCCTGG + Intronic
1009493891 6:64326664-64326686 TACCTGTGGACTACAGCTCCAGG + Intronic
1009564489 6:65294456-65294478 TTGGTATGGCCTACTTCTCCAGG - Intronic
1009651987 6:66488964-66488986 CAGCTCTGGTCTGCAGCTCCCGG + Intergenic
1010168432 6:72944754-72944776 TTGCTCTGTCCTTCAGCTGCTGG - Intronic
1011847938 6:91589987-91590009 CAGCTCCGGCCCACAGCTCCCGG + Intergenic
1014505256 6:122247472-122247494 TTGCTCTGGCCTGTGGCTCCTGG + Intergenic
1014514906 6:122366288-122366310 TTGCTGTGGCCTATGGGTCCAGG + Intergenic
1017834096 6:158161164-158161186 CTGGGCTGGCCTAGAGCTCCTGG - Intronic
1018083095 6:160275828-160275850 TTGCAATGACCTGCAGCTCCTGG + Intronic
1018094622 6:160374419-160374441 CAGCTCTGGTCTGCAGCTCCCGG - Intronic
1020762890 7:12290023-12290045 TTCCTGTGGCCTGCAGCTCAGGG - Intergenic
1021321201 7:19214399-19214421 TTGCTCTGTGCAACTGCTCCCGG + Intergenic
1021787359 7:24165104-24165126 TTGCTCTGGCCTGTGGCTCCTGG + Intergenic
1024622807 7:51177188-51177210 TAGCTCTGCCCCACAGCTCTTGG - Intronic
1026303743 7:69122277-69122299 TCACTGTGGCCTCCAGCTCCTGG + Intergenic
1026836729 7:73644712-73644734 CTTCTTTGTCCTACAGCTCCTGG - Intergenic
1028724237 7:94069491-94069513 TTGCTCTAGCCTTGAGCTCCAGG - Intergenic
1029458226 7:100681678-100681700 CTGCCCTGGCCTACAGCCCAGGG + Exonic
1031196932 7:118627383-118627405 CAGCTCTAGCCTGCAGCTCCTGG - Intergenic
1032064728 7:128758698-128758720 TAGTTTTGGGCTACAGCTCCAGG - Intronic
1032500173 7:132394162-132394184 TTGCTCTTGCATACAGCCCCTGG + Intronic
1033346130 7:140526756-140526778 TTGCTCAGCCCTGAAGCTCCAGG - Intronic
1033653971 7:143361580-143361602 TTTCTCCCGCCTACACCTCCCGG - Intronic
1034215827 7:149404928-149404950 CCGCTCTGGCCTGAAGCTCCTGG + Intergenic
1034860672 7:154592192-154592214 TTACTCTGGCCCACATCTGCTGG - Intronic
1034940122 7:155225257-155225279 TTGCCCAGGCCTACAGCTGGTGG + Intergenic
1035156218 7:156915490-156915512 CAGCTCCGGTCTACAGCTCCCGG - Intergenic
1035287635 7:157816386-157816408 TTGCCCTGCCCTAGAGCTCGTGG - Intronic
1036282966 8:7417296-7417318 TTGCTCGGACATTCAGCTCCTGG + Intergenic
1036338502 8:7894222-7894244 TTGCTCGGACATTCAGCTCCTGG - Intergenic
1037472972 8:19228893-19228915 TTGTTCTGGCCCACGGCTCTGGG + Intergenic
1037960356 8:23092977-23092999 TCCCTCTCGCCCACAGCTCCTGG + Intronic
1037971730 8:23176771-23176793 TCCCTCTTGCCTATAGCTCCTGG - Intergenic
1038036533 8:23691180-23691202 TTGCTCTGGCAGGCAGCTCAGGG - Intergenic
1038275977 8:26121037-26121059 TTGCCCTGGCCTCAAACTCCTGG - Intergenic
1038352106 8:26786148-26786170 CTGCTCTTGCCTTCCGCTCCTGG + Intronic
1039551945 8:38450022-38450044 TTGCTCTGACTTACAGCTGGTGG - Intronic
1040560892 8:48522687-48522709 ATGCTCTGACTTGCAGCTCCCGG - Intergenic
1045265602 8:100616372-100616394 TAGCTCTGGGGTACAGCTGCAGG - Intronic
1045996471 8:108367557-108367579 TTGCTTTGGGCTTCTGCTCCTGG + Intronic
1046851763 8:118982538-118982560 ATGTTCTGGCCTACAGCACTTGG - Intergenic
1048707098 8:137165991-137166013 TTTCTCTGCCATACAGCTGCAGG - Intergenic
1048971054 8:139645189-139645211 TTCCTCGGGCCCACAGCACCTGG - Intronic
1049367006 8:142244674-142244696 TTGGGCTGGCCTCCACCTCCCGG - Intronic
1049424653 8:142532729-142532751 TTGCTCTGCCCTTCAGGGCCTGG + Intronic
1049636386 8:143691749-143691771 TCCCTGTGGCCCACAGCTCCTGG + Intronic
1050244814 9:3677695-3677717 ATGCTCTGGCCTAGAGCTCTAGG - Intergenic
1050488333 9:6159944-6159966 TTTCTCTTGCCCCCAGCTCCTGG - Intergenic
1050808980 9:9719562-9719584 TTGTTCTGGCCTGCAAATCCTGG - Intronic
1052690511 9:31810218-31810240 TTCCTCTTGTCTACAGCTCATGG - Intergenic
1055150254 9:72989460-72989482 TTGCTCAGGCTTAGAACTCCTGG + Intronic
1056119345 9:83471865-83471887 TTGATCTGGACTCCAGCTCTGGG + Intronic
1056515147 9:87343083-87343105 GTGCTCGGGCCTTCACCTCCTGG - Intergenic
1057125379 9:92612096-92612118 TTGTTCTGGCTCACACCTCCTGG + Intronic
1058259716 9:102814085-102814107 CAGCTCTGGTCTGCAGCTCCCGG + Intergenic
1060973055 9:127749719-127749741 TTGCTCTGTCCCCCAGATCCTGG - Intronic
1061153149 9:128840763-128840785 TTGCACTGGCCTCAAACTCCTGG + Intronic
1061919942 9:133777232-133777254 TCTCTCTGGGCTCCAGCTCCAGG + Intronic
1062467168 9:136686568-136686590 CGCCCCTGGCCTACAGCTCCGGG - Intronic
1062503972 9:136863430-136863452 TTGTTCTGGCCAGCAGCCCCTGG + Exonic
1203574807 Un_KI270744v1:167145-167167 CTGCTGCAGCCTACAGCTCCTGG - Intergenic
1186192282 X:7077382-7077404 TTGCACTGGCCACCAGCTCGGGG - Exonic
1186585326 X:10867254-10867276 CTGCTCTGTCCTGCAGCTCATGG + Intergenic
1186820797 X:13285599-13285621 CCCCTCTGGCCCACAGCTCCAGG - Intergenic
1191710646 X:64147152-64147174 TTGCTCTTCCCCTCAGCTCCTGG - Intergenic
1192018361 X:67357471-67357493 GAGCTCTGGTCTGCAGCTCCAGG + Intergenic
1192374606 X:70547212-70547234 TTGCTCCCACCTTCAGCTCCAGG - Intronic
1193190471 X:78564159-78564181 TAGCTCTGGTCTACAGCTCCCGG - Intergenic
1195321420 X:103724679-103724701 GTGCCCTGGCCTGCAGCTCAGGG - Intronic
1196215957 X:113051459-113051481 TTTCCCTGACCCACAGCTCCAGG + Intergenic
1196631397 X:117944202-117944224 CAGCTCTGGTCTGCAGCTCCCGG - Intronic
1197727721 X:129787538-129787560 TGGCTCTGGCCTCCATGTCCTGG - Intronic