ID: 989585486

View in Genome Browser
Species Human (GRCh38)
Location 5:43071288-43071310
Sequence GTTAACACGCTGACATCTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989585482_989585486 21 Left 989585482 5:43071244-43071266 CCTGGAGCTGTAGGCCAGAGCAA 0: 1
1: 0
2: 3
3: 31
4: 257
Right 989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG 0: 1
1: 0
2: 0
3: 10
4: 106
989585484_989585486 7 Left 989585484 5:43071258-43071280 CCAGAGCAAGACCACAGGACTGA 0: 1
1: 0
2: 1
3: 15
4: 210
Right 989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG 0: 1
1: 0
2: 0
3: 10
4: 106
989585481_989585486 22 Left 989585481 5:43071243-43071265 CCCTGGAGCTGTAGGCCAGAGCA 0: 1
1: 1
2: 1
3: 35
4: 315
Right 989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG 0: 1
1: 0
2: 0
3: 10
4: 106
989585480_989585486 26 Left 989585480 5:43071239-43071261 CCAGCCCTGGAGCTGTAGGCCAG 0: 1
1: 1
2: 7
3: 59
4: 285
Right 989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG 0: 1
1: 0
2: 0
3: 10
4: 106
989585485_989585486 -4 Left 989585485 5:43071269-43071291 CCACAGGACTGACAGAGCTGTTA 0: 1
1: 0
2: 2
3: 15
4: 153
Right 989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG 0: 1
1: 0
2: 0
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989585486 Original CRISPR GTTAACACGCTGACATCTTT CGG Intronic
903683657 1:25114934-25114956 ATTAGAATGCTGACATCTTTGGG + Intergenic
904547483 1:31287287-31287309 GTTAAAAAGCAGTCATCTTTAGG + Intronic
904590617 1:31613437-31613459 GTTAGGACGTGGACATCTTTGGG + Intergenic
905541268 1:38762326-38762348 GTTAGAACACAGACATCTTTGGG + Intergenic
911986491 1:104632081-104632103 GTTTACACACTGTCATATTTAGG - Intergenic
913968443 1:143395661-143395683 GTTAGGACGTGGACATCTTTGGG - Intergenic
914062821 1:144221257-144221279 GTTAGGACGTGGACATCTTTGGG - Intergenic
914116329 1:144745097-144745119 GTTAGGACGTGGACATCTTTGGG + Intergenic
915608708 1:156972831-156972853 GTTAACCCTCTGACTGCTTTGGG + Intronic
917904815 1:179578124-179578146 GTTAAGAAACTGACATCTGTGGG + Intergenic
919944233 1:202308064-202308086 GTTAACACAAAGACTTCTTTTGG + Intronic
920637042 1:207713820-207713842 GTTAACACACCGCCATCTGTTGG - Intronic
921151548 1:212407012-212407034 ATTAACACTTGGACATCTTTGGG - Intronic
921550187 1:216526225-216526247 GTTAGGACTCTAACATCTTTTGG - Intronic
1069028652 10:63571688-63571710 ATTAAGACACAGACATCTTTAGG + Intronic
1075015891 10:118909797-118909819 AGTAAGACCCTGACATCTTTGGG - Intergenic
1077853177 11:6095686-6095708 GTTAACTGGCTGACTTCTATGGG - Intergenic
1080796226 11:35566070-35566092 TTTAACACGTTGTCATCATTTGG + Intergenic
1081350503 11:42046077-42046099 ATTAGGACGTTGACATCTTTGGG - Intergenic
1085570966 11:77557723-77557745 GTTAAGATGCTGCCATCTTGTGG + Intronic
1086005804 11:82034081-82034103 ATTAAGACCCTGAAATCTTTAGG - Intergenic
1087110336 11:94459873-94459895 TTTAAGACGTGGACATCTTTAGG - Intronic
1087367541 11:97239900-97239922 CTTAACACTCTGACTTGTTTAGG - Intergenic
1093914143 12:24781779-24781801 ATTAAGACACAGACATCTTTTGG + Intergenic
1099426232 12:82526546-82526568 ATTAATACTCTGACATTTTTAGG + Intergenic
1101212739 12:102550982-102551004 ATAAAAACACTGACATCTTTTGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1107249565 13:38342344-38342366 GTTAATACTCTGATAGCTTTGGG + Intergenic
1109623659 13:64944531-64944553 GATAACACACTGTCATCATTAGG + Intergenic
1111204048 13:84980380-84980402 GTAAACAAGCTGATATGTTTTGG - Intergenic
1112746776 13:102535753-102535775 GTTAGAACACGGACATCTTTTGG + Intergenic
1113993352 14:16046250-16046272 GTTTAAATGCTGACATATTTAGG - Intergenic
1120458987 14:84769170-84769192 GTTAACAGGCTTCCATCTGTGGG + Intergenic
1122695161 14:103548837-103548859 CTCAACACGCTGACACCTGTGGG - Intergenic
1122869711 14:104632502-104632524 GTTAACACTGTGACTTGTTTAGG - Intergenic
1125620241 15:41054340-41054362 GTTAATTTGCTGACATCCTTTGG - Intronic
1128466692 15:67918546-67918568 GTTAACACACTGCCATCCATTGG - Intergenic
1131218889 15:90564344-90564366 GTTAACCCTATGACATCATTAGG + Intronic
1131628746 15:94152886-94152908 GTTAGTACACTGACATCCTTGGG - Intergenic
1137583256 16:49647390-49647412 GTTAAGACTTGGACATCTTTGGG - Intronic
1139287321 16:65827201-65827223 TTTAAGACGTGGACATCTTTGGG + Intergenic
1149218688 17:54389384-54389406 GTTAACATGCCGCCATCTGTTGG + Intergenic
1149854289 17:60066517-60066539 AATAACACATTGACATCTTTAGG - Intronic
1154114517 18:11600151-11600173 GTTTAAACGCTTTCATCTTTTGG - Intergenic
1155974285 18:32111174-32111196 GTTAACACGCAGATAACTTTGGG + Intronic
1158687548 18:59628470-59628492 GGTAAAAAGCTGCCATCTTTAGG - Intronic
1159434206 18:68394962-68394984 GTTAAGATGCTGACATCCTTGGG + Intergenic
1161761973 19:6180252-6180274 GTTAGAACGTGGACATCTTTAGG + Intronic
1202702231 1_KI270712v1_random:173129-173151 GTTAGGACGTGGACATCTTTGGG - Intergenic
926124764 2:10265305-10265327 ATTAGGACGCGGACATCTTTGGG + Intergenic
930787510 2:55285012-55285034 ATTAACCAGCTTACATCTTTAGG + Intergenic
934053621 2:88232858-88232880 ATTAACACAGAGACATCTTTGGG - Intergenic
934173145 2:89556576-89556598 GTTAGGACGTGGACATCTTTGGG - Intergenic
934283461 2:91630933-91630955 GTTAGGACGTGGACATCTTTGGG - Intergenic
934843962 2:97649757-97649779 TTTATGACGCGGACATCTTTGGG - Intergenic
935627608 2:105184296-105184318 GTTAAAACGCTGCCATACTTAGG + Intergenic
935988687 2:108699376-108699398 GTTAAGACGCAAACATATTTAGG - Intergenic
938218705 2:129546442-129546464 GTGAACACACTGATATCATTTGG - Intergenic
941318211 2:164021481-164021503 GATAACATGCTGGCAGCTTTAGG - Intergenic
941928383 2:170917556-170917578 GTTAACATGCCGCCATCTGTTGG - Intergenic
944314318 2:198269022-198269044 GTTAAAATGTGGACATCTTTAGG - Intronic
948193935 2:236081001-236081023 ATTAGGACGTTGACATCTTTGGG + Intronic
1171327946 20:24312224-24312246 TCTAGCACTCTGACATCTTTGGG + Intergenic
1171368188 20:24641212-24641234 TTTCACACGCAGACATGTTTAGG + Intronic
1171811671 20:29749609-29749631 GTTTAAATGCTGACATATTTAGG + Intergenic
1174437369 20:50519711-50519733 GTTAACACAGTGTCATCGTTTGG + Intronic
1174690567 20:52500140-52500162 ATTAAGAGGCTGACATTTTTTGG - Intergenic
1177962352 21:27682946-27682968 GTTGACAACATGACATCTTTGGG - Intergenic
1180313916 22:11261263-11261285 GTTTAAATGCTGACATATTTAGG + Intergenic
1180341431 22:11622264-11622286 GTTTAAATGCTGACATATTTAGG - Intergenic
951921654 3:27861269-27861291 GCTCACACCCTGACACCTTTAGG + Intergenic
955598528 3:60618626-60618648 ATTAAAACGTTGACATCTTTAGG - Intronic
956347484 3:68296968-68296990 GTTAACACTCTTTCATATTTTGG - Intronic
956391241 3:68775047-68775069 GTTAACATCCTCACATCCTTTGG - Intronic
956948271 3:74249482-74249504 GTTAACAACCTCTCATCTTTTGG - Intergenic
965921391 3:173919213-173919235 ATTAAGACTCAGACATCTTTGGG + Intronic
966201114 3:177360074-177360096 AATAACACGCTGACATCATCAGG + Intergenic
971119135 4:23684610-23684632 GTTAGCAAGCTGACTTCCTTAGG + Intergenic
972967046 4:44523632-44523654 ATTAAGATGCAGACATCTTTGGG - Intergenic
980363335 4:131765478-131765500 TTTAACACACTGATATCATTTGG - Intergenic
985357224 4:189134324-189134346 GTTAGCAAGCTGACCTATTTAGG - Intergenic
986460573 5:7966925-7966947 ATTAAGACGTGGACATCTTTGGG - Intergenic
989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG + Intronic
991362558 5:65836086-65836108 TTTAACATACTGACATATTTGGG - Intronic
995387161 5:111600696-111600718 ATTAACACGTGGACATCTTTGGG + Intergenic
996945755 5:129065713-129065735 ATTAAGACGTAGACATCTTTTGG - Intergenic
1000895188 5:166846699-166846721 ATTAAGACACAGACATCTTTGGG + Intergenic
1003487651 6:6593444-6593466 GTTAAGAGGTAGACATCTTTGGG + Intronic
1005441767 6:25876924-25876946 GTTATCAGGCTGACATCATCTGG + Intronic
1006764361 6:36491660-36491682 GTTAACAGGTTAACATCTCTGGG + Intergenic
1012371657 6:98514518-98514540 GGTAAAATGCTGCCATCTTTTGG + Intergenic
1014512545 6:122341975-122341997 GTTAGGACGTAGACATCTTTGGG - Intergenic
1022302015 7:29110671-29110693 ATTAAGACACTAACATCTTTAGG - Intronic
1028460394 7:91085569-91085591 GTTAACAGGTGGACATCTTTGGG + Intronic
1029962180 7:104699807-104699829 GTTTACACGCTGACATCAGCTGG + Intronic
1031416797 7:121505032-121505054 GTTAACAACCTGACATTGTTTGG - Intergenic
1031534093 7:122912379-122912401 GTTAGCATGTAGACATCTTTAGG + Intergenic
1032544441 7:132729926-132729948 GTGAACACGCTGATATGTTGAGG + Intergenic
1034479390 7:151308011-151308033 GTTAAGACTTTGGCATCTTTTGG - Intergenic
1034501014 7:151451203-151451225 ATTAAGACGTGGACATCTTTGGG + Intergenic
1035734820 8:1880563-1880585 GTTAAAACGCTGAAAAATTTTGG - Intronic
1035982396 8:4387161-4387183 GTTAACACAATGCCATCTTGTGG + Intronic
1037209379 8:16367251-16367273 GTGAATACCCTGACATCTTTGGG - Intronic
1037280338 8:17234162-17234184 TGTAACAAGCTGACATCTTTTGG + Intronic
1039997955 8:42550756-42550778 GTTAAGATGTGGACATCTTTGGG + Intronic
1045239004 8:100381801-100381823 GTTAAAACACTTACATATTTGGG + Intronic
1046248595 8:111600345-111600367 ATTAAGACACGGACATCTTTGGG + Intergenic
1047063595 8:121255154-121255176 ATTAAGACACTGACATCTTTGGG - Intergenic
1047407221 8:124595726-124595748 GTTAGAACGTGGACATCTTTGGG + Intronic
1047700892 8:127448387-127448409 GTTAAGATGTGGACATCTTTGGG - Intergenic
1055799613 9:80020771-80020793 GTGATCAGGCTGACTTCTTTTGG + Intergenic
1058127185 9:101208466-101208488 GTAAACACTCTTACCTCTTTTGG + Intronic
1060235773 9:121861707-121861729 GTTGACATGCTGTCATCCTTGGG - Intronic
1060626175 9:125114120-125114142 GTAAATACGGTGACATCTGTCGG + Intronic
1186730799 X:12407230-12407252 GTTAAAATGCAGACATCTTTGGG + Intronic
1188460366 X:30419045-30419067 GTCAACATGCTGCCAGCTTTGGG - Intergenic
1196632647 X:117961457-117961479 GTTAAGATGTGGACATCTTTAGG - Intronic