ID: 989586198

View in Genome Browser
Species Human (GRCh38)
Location 5:43075480-43075502
Sequence CGGCCTCTTTCTCGATCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 2, 1: 23, 2: 29, 3: 38, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989586195_989586198 10 Left 989586195 5:43075447-43075469 CCCAGTCTAACATGACTGCTATG 0: 1
1: 0
2: 6
3: 31
4: 180
Right 989586198 5:43075480-43075502 CGGCCTCTTTCTCGATCTTCAGG 0: 2
1: 23
2: 29
3: 38
4: 126
989586196_989586198 9 Left 989586196 5:43075448-43075470 CCAGTCTAACATGACTGCTATGT 0: 1
1: 0
2: 4
3: 21
4: 115
Right 989586198 5:43075480-43075502 CGGCCTCTTTCTCGATCTTCAGG 0: 2
1: 23
2: 29
3: 38
4: 126
989586194_989586198 30 Left 989586194 5:43075427-43075449 CCTCTGTAAACAGGAAGTGTCCC 0: 14
1: 13
2: 4
3: 13
4: 121
Right 989586198 5:43075480-43075502 CGGCCTCTTTCTCGATCTTCAGG 0: 2
1: 23
2: 29
3: 38
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989586198 Original CRISPR CGGCCTCTTTCTCGATCTTC AGG Intronic
900721317 1:4177618-4177640 TGGCCTCTTTCTCGATCTCCAGG - Intergenic
904716395 1:32470999-32471021 CAGCCTCCTTCTCCATCTTTCGG - Exonic
907164230 1:52396056-52396078 CAGCCTCTTTCTGGCTCTTGGGG + Exonic
909582155 1:77248718-77248740 TGTCCTCTTTCTCCATCTTTGGG - Intergenic
910354397 1:86339541-86339563 CGTCCTCTTTCTCAATCTTCAGG - Intergenic
912967935 1:114252605-114252627 CAGTCTCTTTCTAGCTCTTCAGG - Intergenic
913236464 1:116788532-116788554 CTCCCTCTTTCTCCATCTTTTGG - Intergenic
915046663 1:153023190-153023212 TGGCCTCTTTCAGGATCTTCAGG + Intergenic
915156969 1:153885052-153885074 CGGCCCTGTTCTCCATCTTCTGG + Intronic
917726927 1:177837070-177837092 CTCCCTCTTTCCCCATCTTCAGG - Intergenic
918356345 1:183709119-183709141 CGGCCTCTCTCTCAGCCTTCAGG + Intronic
918372001 1:183870253-183870275 CGGCCTCTTTCTCGGTCTTCAGG + Intronic
919391978 1:196997118-196997140 CCGCCTCTCTCTCCATCTCCTGG + Intronic
919933925 1:202239094-202239116 TGGCCTCTTTCTCCATCTTCAGG + Intronic
921274610 1:213506646-213506668 CTGTCTCTTTCTCTATCTCCTGG - Intergenic
922088002 1:222369453-222369475 TGGCCTCTTTCTCCATCTTCAGG + Intergenic
922571305 1:226636035-226636057 TGGCCTCTTTCTAGACCTTAAGG + Intronic
922685483 1:227635717-227635739 TGGCCTCTTTCTCAATCTTCAGG + Intronic
923962624 1:239102499-239102521 CGACCCCTTTCTCGCTTTTCTGG + Intergenic
924719336 1:246607652-246607674 TGGCCTCTCTCTCGATCCTCAGG + Intronic
1065867847 10:29929069-29929091 CAGCCTCTTTCTCGATCTTCGGG + Intergenic
1068161913 10:53275514-53275536 TTGCCTCTTTCTCAATCTTTTGG - Intergenic
1069113211 10:64472053-64472075 TTGCCTCTTTCTCTATCTTGTGG - Intergenic
1070382992 10:75898348-75898370 TGTCCTCTTTCTAGAACTTCTGG - Intronic
1072272356 10:93789193-93789215 CCCCCTCTTTCTCCTTCTTCTGG - Intronic
1079727245 11:23891741-23891763 CGGCCCCTTTCCCGCTTTTCTGG - Intergenic
1080387103 11:31816771-31816793 CGCCCCCTTTCTAGGTCTTCTGG - Intronic
1081210294 11:40325128-40325150 CTGGCTCTTTCTCATTCTTCAGG - Intronic
1081600078 11:44486855-44486877 TGGCCTCTTTCTAGATCTTCAGG - Intergenic
1082632449 11:55558243-55558265 CGGCCTCTTTCTCGATTTTCAGG - Intergenic
1082635434 11:55587517-55587539 CGACCTCTTTCCCAATCTTCAGG - Intergenic
1083063576 11:59899720-59899742 TGGCCTCTCTCTCGATCTGCAGG + Intergenic
1083381648 11:62274199-62274221 TGGCCTCTTTCTCCGTCTTCAGG + Intergenic
1083432466 11:62621453-62621475 CTGCCTCTTTCTCATCCTTCAGG - Intronic
1084575803 11:69987149-69987171 GGGCCCCTTTCTCTTTCTTCTGG - Intergenic
1088489704 11:110375047-110375069 CTGGCTCTTTCTCATTCTTCAGG - Intergenic
1094825600 12:34266803-34266825 CGACCTCTTTCCCGCTTTTCTGG + Intergenic
1100089045 12:90947786-90947808 TGGCCTCTTTCTCTATCTTCAGG - Intronic
1100299034 12:93290407-93290429 CGGCCTCTTTCTCAATCTTCAGG + Intergenic
1105202649 13:18193389-18193411 CTGCCTCTTTCTGGTGCTTCAGG - Intergenic
1105618470 13:22043555-22043577 CAGCCTCTATCTGAATCTTCTGG + Intergenic
1106476172 13:30100018-30100040 AGGCCTCTGTCTCCAGCTTCTGG + Intergenic
1106617915 13:31347382-31347404 TGGCTTCTTCCTCGATCTTCAGG - Intergenic
1107135641 13:36941033-36941055 CTGCCCCTTTCTCGGTCTTTTGG + Intergenic
1108050872 13:46437576-46437598 CGCCTTTTTTCTCGTTCTTCAGG + Intronic
1108271173 13:48760940-48760962 TGGCCTCTTTTTCGATCTTCAGG - Intergenic
1109543439 13:63811196-63811218 CGCCTTTTTTCTCGTTCTTCAGG + Intergenic
1110144326 13:72170735-72170757 TGCCCTCTTTCTGGATCTTTAGG + Intergenic
1110323000 13:74181383-74181405 CAGCCTCATTCTCAATTTTCTGG - Intergenic
1110627859 13:77671641-77671663 TGCCCTCTTTCTCTATCTTGTGG - Intergenic
1110661361 13:78062031-78062053 TGGCCTCCCTCTCGATCTTCGGG - Intergenic
1112022716 13:95385492-95385514 TGGCCTCAGCCTCGATCTTCTGG + Intergenic
1112868427 13:103937795-103937817 CAGCCTCTCTCTCGGTCTTCAGG + Intergenic
1114236777 14:20830985-20831007 TGGCCTCTTTCTCGATCTTCAGG + Intergenic
1114237676 14:20836531-20836553 CGGCCTCTTTTTCAATCTTCAGG + Intergenic
1114773760 14:25458094-25458116 TGGCCTCTTTCTGGATCTTCAGG - Intergenic
1116534943 14:46016957-46016979 CGACCCCTTTCCCGATTTTCTGG - Intergenic
1117969673 14:61239495-61239517 TGGCCTCTCTCTCCCTCTTCAGG + Intronic
1118941616 14:70344803-70344825 TGGCCTCTTTCTCAATCTTCAGG - Intronic
1118942489 14:70350248-70350270 TGGCCTCTTTCTGGGTCTTCAGG - Intronic
1119249104 14:73136755-73136777 CGGCCCGTTTCTCGGGCTTCGGG + Intronic
1120673193 14:87387931-87387953 TGGCCTCTTTCTTGATCTTCAGG + Intergenic
1122360689 14:101160374-101160396 TGGCCTCTTTCTTGATCTTTAGG - Intergenic
1122378895 14:101287517-101287539 TGGCCTCTTCCTTCATCTTCAGG - Intergenic
1127517122 15:59706787-59706809 AGGCCTCTGTCTAGATCTTTAGG - Intergenic
1128925390 15:71650656-71650678 TGGCCTCTTTCTTGATTTTCAGG - Intronic
1130743994 15:86631062-86631084 AGGCCTCTTTCTCCATCTTCAGG + Intronic
1131000894 15:88939132-88939154 CAGCCTTTCTCTCGGTCTTCAGG + Intergenic
1131324606 15:91430178-91430200 TGGCCTCTTTCTAAACCTTCAGG - Intergenic
1131407105 15:92174217-92174239 CGACCTCTTTCCCAGTCTTCAGG + Intergenic
1132841434 16:1980131-1980153 CAGCCTCTTTCTCGCGCTGCGGG - Exonic
1135960637 16:26991963-26991985 TGGCCTCTTCCTTCATCTTCAGG + Intergenic
1136034717 16:27530463-27530485 CTGCCTCTTTCTCTTTCTGCTGG - Intronic
1137532446 16:49287950-49287972 CTTCCTCCTTCTCCATCTTCAGG + Intergenic
1138031133 16:53560254-53560276 TGGCCTCTTTCTCGATCTTCAGG - Intergenic
1144047805 17:11469315-11469337 TGGCCCCTTCCTCCATCTTCAGG - Intronic
1146431099 17:32795774-32795796 TGGCCTCTTTCTCAGTCTTTAGG - Intronic
1146503837 17:33387484-33387506 CAACCTCTTTCTCATTCTTCTGG + Intronic
1150069845 17:62141042-62141064 CGGCCTCCCTCTCAATCTTCCGG - Intergenic
1155657477 18:28209053-28209075 CGGCCTCTCTTTCGGTCTTCAGG + Intergenic
1155804212 18:30145397-30145419 TGGCCTCTTTCTCGATTTTCAGG - Intergenic
1157918972 18:51696764-51696786 TGGCCTTTTTCTCGATCTTCAGG - Intergenic
1157920661 18:51709948-51709970 TGGCCTTTTTCTTGATCTTCAGG - Intergenic
1158075249 18:53520532-53520554 TGGCTTCTTTCTTGATTTTCTGG - Intronic
1158787157 18:60728036-60728058 TTGTCTCTTTCTCCATCTTCTGG + Intergenic
1159915822 18:74186887-74186909 CAGCCTCTTTCTCGATCTTCAGG - Intergenic
1163938758 19:20474183-20474205 CAGCCTCTTTCTCAAACTTCAGG + Intergenic
1163939728 19:20480528-20480550 CGGCCTCTTTCTTGATCTTCAGG + Intergenic
1164174810 19:22762595-22762617 CTCCCTCTTTCTCTATCTTATGG - Intronic
1164236807 19:23344874-23344896 TGGCCTCCCTCTGGATCTTCAGG - Intronic
1164580826 19:29433867-29433889 CAGCCTCTTTCTCCTTCTCCAGG + Intergenic
1166778597 19:45327704-45327726 CAGCCTCTTTCTAGGTCATCAGG + Intergenic
925651970 2:6100380-6100402 GGCCCTCTTTCTCTATCTTTTGG + Intergenic
925860906 2:8174337-8174359 CTTCCTCTTTCTCGAACCTCTGG - Intergenic
925955292 2:8957931-8957953 AGGTCTCTTTCTCAATCCTCAGG - Intronic
926278713 2:11426405-11426427 AGGCCTCTTTCTCCATCTTCAGG - Intergenic
927376395 2:22419940-22419962 TGGCCTCTCTCTTGATCTTCAGG + Intergenic
930533041 2:52614088-52614110 TGGCCTCTTTCTCGATCTTCAGG - Intergenic
931588030 2:63849733-63849755 CGCCCTGTTTCTCATTCTTCTGG - Intronic
933167464 2:79092246-79092268 TGGCCTTTTTCTGGATCTTCAGG + Intergenic
933168535 2:79099461-79099483 TGGCCTGTTTCTCGATCTTAAGG + Intergenic
935719633 2:105968582-105968604 TGGCCTCCTTCTCAATCTTCAGG + Intergenic
936633716 2:114232685-114232707 CTCCCTCTTTCTCTAGCTTCTGG + Intergenic
939324565 2:140671591-140671613 TGGCCTCTTTCTCCACCTTCAGG + Intronic
939496191 2:142931048-142931070 TGGCCTCTTTCTCGATCTTCAGG + Intronic
939497090 2:142937101-142937123 TGGCCTCTTTCTCGATCTTCAGG + Intronic
940287940 2:152050847-152050869 CAGCCTCGATCTCGATCTACCGG + Intronic
942552806 2:177137363-177137385 CAGCCCCTTTCCCCATCTTCTGG + Intergenic
945292475 2:208139596-208139618 TGGCCTCTTTCTCGATCTTCGGG - Intergenic
945489151 2:210434563-210434585 TTGCCTCTTTCTCTTTCTTCAGG - Exonic
946669673 2:222089363-222089385 CGGGCTCTCTCTCCATCCTCTGG + Intergenic
1171097985 20:22350629-22350651 CGGCCTCTTCCTCTGTGTTCTGG - Intergenic
1171172052 20:23024139-23024161 CGGCCTCTTTCTCGATCTTCAGG + Intergenic
1171172214 20:23025713-23025735 TGGCCTGTTTCTCAATCTTCAGG + Intergenic
1173449707 20:43151930-43151952 CAGCCTTCTTCTCCATCTTCAGG - Intronic
1173554242 20:43954274-43954296 CAGCCTCCTTCTCTCTCTTCTGG + Intronic
1174354791 20:49990492-49990514 CGGCATCTTTCTCCTCCTTCAGG - Intergenic
1176715303 21:10344620-10344642 CTGCCTCTTTCTGGTGCTTCAGG + Intergenic
1179666577 21:42916955-42916977 CGACCTCCCTCTTGATCTTCAGG + Intergenic
1181595459 22:23911674-23911696 TGGCCTCTCTCTTGATCTTCAGG - Intergenic
1182966462 22:34526156-34526178 TAGACTCTTTCTCTATCTTCTGG + Intergenic
951609453 3:24475974-24475996 CAGGCTCTTTCCTGATCTTCAGG - Intronic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
954757323 3:52848319-52848341 CAGCCTCTTTCTCAATCTCTTGG - Intronic
957801026 3:85081718-85081740 CGGCCTCTTCCTCGATGCCCTGG - Intronic
959756680 3:109907806-109907828 TTCCCTCTTTCTCGATCTTGTGG + Intergenic
959998372 3:112703349-112703371 CTCCCTCTTTCTCTATCTTGTGG - Intergenic
960719917 3:120616002-120616024 CGGCCTCTTCCTCAGTCTTCGGG + Intergenic
960778521 3:121290513-121290535 TTCCCTCTTTCTCTATCTTCTGG - Intronic
963975569 3:151476489-151476511 TGGCCTCTTTCTCGATCTTCAGG + Intergenic
965871788 3:173274226-173274248 CGGCCTCTTTTTCAATCTGCAGG - Intergenic
965872930 3:173281739-173281761 CGGCCTCTGTCTCAATCTTCAGG - Intergenic
969077594 4:4592583-4592605 CAGCCTCTTTCTCCCTCTCCTGG - Intergenic
970793422 4:19887322-19887344 TGGCCTCTTTCTGGATCTTCAGG - Intergenic
970794465 4:19894130-19894152 TGGCCTCTTTCTCGATCTTCAGG - Intergenic
971812342 4:31442253-31442275 TGGCCTCTTTCTCAATCTTCAGG - Intergenic
972800577 4:42471873-42471895 CGGCATCTTTCAGGCTCTTCTGG + Intronic
973051709 4:45607094-45607116 CAGCCTCTGTCTCAATCTTCAGG - Intergenic
973068870 4:45832468-45832490 TTCCCTCTTTCTCTATCTTCTGG + Intergenic
974489650 4:62548363-62548385 CGACCTCTCTCTTGGTCTTCAGG + Intergenic
974950860 4:68581958-68581980 CGGTCTCTTTCTTGATCTTCAGG - Intronic
974958401 4:68671910-68671932 TGGCCTATTTCTTGATCTTCAGG - Intergenic
976299524 4:83505110-83505132 TGGCCTCTTTCTTGAGCTTCAGG + Intronic
977975808 4:103265381-103265403 CTCCCTCTTTCTCTATCTTGTGG + Intergenic
980378709 4:131980923-131980945 CCGTCTCTTTCTCTCTCTTCTGG + Intergenic
984387273 4:179077219-179077241 CAGCCTCCCTCTGGATCTTCAGG + Intergenic
984694337 4:182764577-182764599 CAGTCTCTTTCTCTCTCTTCTGG - Intronic
985107977 4:186517316-186517338 CTCCCTCTTTCTCTATCTTTTGG + Intronic
985240429 4:187925674-187925696 CTCCCTCTTTCTCTATCTTGTGG + Intergenic
988234294 5:28520887-28520909 ATGCCTCTTTCTTGATTTTCTGG - Intergenic
989003440 5:36784141-36784163 CGGCCTCCCTCTCCATCTTCAGG - Intergenic
989095496 5:37777700-37777722 CGGCCGCTCTCTCGGTCTTCAGG - Intergenic
989586198 5:43075480-43075502 CGGCCTCTTTCTCGATCTTCAGG + Intronic
991256283 5:64618587-64618609 TGGCCCCTTTCTCCATCTTTAGG + Intergenic
994402955 5:99305318-99305340 TGGCTTCTTCCTCGTTCTTCTGG + Intergenic
994630323 5:102277138-102277160 CTGCTTCTTTCTTGATCTTTTGG - Intronic
997045746 5:130314844-130314866 GTGCCTCTTTCTCTATGTTCTGG + Intergenic
999413527 5:151374180-151374202 CGGACTCTTTCTCGATCTTCAGG - Intergenic
1002395210 5:178947079-178947101 CAGGCTCTTTCTCAATCCTCAGG - Intronic
1002764505 6:227404-227426 TGGCCTTTGTCTCCATCTTCTGG - Intergenic
1005142076 6:22643877-22643899 TGGCCTCTTCCTCAATCTTCAGG + Intergenic
1005636726 6:27759782-27759804 CGGCCTCATTCTTGTTCTTTTGG + Intergenic
1011813502 6:91160515-91160537 TGGCCTCTCTCTGGGTCTTCAGG + Intergenic
1015182203 6:130372139-130372161 AGACCTCTTCCTGGATCTTCAGG + Intronic
1015238064 6:130993602-130993624 CGGCCTCCCTCTCGATCTTCAGG + Intronic
1016204372 6:141453981-141454003 CGACCCCTTTCTCAATTTTCTGG + Intergenic
1016291936 6:142536650-142536672 TGGCCTCTTTCTTGCTCTTCAGG - Intergenic
1016292900 6:142543007-142543029 CGGCTTCTTTCTCGATCTTCAGG - Intergenic
1016482736 6:144499301-144499323 CAGCCTCTTTCTTCATTTTCCGG - Exonic
1017015768 6:150098398-150098420 TGGCCTCTCTCTCGGTCTTCAGG - Intergenic
1017016120 6:150100840-150100862 CGGCCTCTCTCTCGGTCTTCAGG - Intergenic
1017556039 6:155569828-155569850 CTCCCTCTTTCTCTATCTTTTGG + Intergenic
1019819477 7:3231229-3231251 CTGCCTCTTTCCCGATCCTCCGG + Intergenic
1022003986 7:26250372-26250394 TGGCCTCTTTCTGGATCTTCAGG - Intergenic
1022449507 7:30502045-30502067 CTGCCTCTTTCCTGATTTTCAGG + Intronic
1026509697 7:71017791-71017813 TGGCCTCTTTCTCGATCTTCAGG - Intergenic
1027626873 7:80556060-80556082 CTCCCTCTTTCTCAATCTTTTGG + Intronic
1028044293 7:86096134-86096156 CTGCCTCTTTCACTATCTCCTGG + Intergenic
1029803338 7:102973381-102973403 TGGCCTGTTTCTCGATCTTCAGG - Intronic
1029804136 7:102978493-102978515 TGGCCTCTTTCTCAATCTTCAGG - Intronic
1030185423 7:106757146-106757168 TGGCCTCTCTCTCAGTCTTCAGG + Intergenic
1030923048 7:115416311-115416333 TAGCCTCATTCTCTATCTTCAGG - Intergenic
1031479684 7:122263465-122263487 TTGCCTCATTCTCAATCTTCGGG - Intergenic
1032385735 7:131522012-131522034 CTGCCTCTTCCTAGATGTTCGGG - Intronic
1034580338 7:152035925-152035947 TGGCCTCCCTCTTGATCTTCAGG + Intronic
1041916425 8:63144102-63144124 CGGCCTCTCTCTCAGTCTTCAGG + Intergenic
1042157668 8:65863386-65863408 TGGCCTCCGCCTCGATCTTCAGG - Intergenic
1042158700 8:65870235-65870257 CAGCCTCCCTCTTGATCTTCAGG - Intergenic
1042840272 8:73116677-73116699 TGACCTCTTTCTTGTTCTTCTGG - Intronic
1043506706 8:80909923-80909945 CGGCCTCCCTCTAGGTCTTCAGG + Intergenic
1043642129 8:82467550-82467572 CTTCCTCTTTCTCCATCTTATGG - Intergenic
1043768722 8:84169767-84169789 TGGCCTCCCTCTAGATCTTCAGG + Intergenic
1043856741 8:85273624-85273646 TGGCCTCCCTCTCGGTCTTCAGG - Intronic
1043856801 8:85273988-85274010 CGGCCTCCGTCTCGGTCTTCAGG + Intronic
1044890964 8:96835159-96835181 TGGCCTCCTTCTCCATCTACAGG + Exonic
1047209527 8:122830266-122830288 TGGCCTGTTTCTTGATCTTCAGG + Intronic
1047957742 8:129988197-129988219 TGGCCTCTTTCTCGATCTTCAGG + Intronic
1048716922 8:137281467-137281489 TGGCCTCTTTCTCGATCTTCAGG - Intergenic
1048717843 8:137287574-137287596 TGGCCTCTTTCTCGATCTTCAGG - Intergenic
1051945039 9:22558206-22558228 TGGCCTCTTTCAAGAACTTCTGG + Intergenic
1057736498 9:97666817-97666839 CCAGCTCTTTCTGGATCTTCAGG - Exonic
1058286833 9:103189165-103189187 CTGCCTCTTTCTCGAACTTCAGG + Intergenic
1062209394 9:135355668-135355690 CGGCCTCTTCCGCCAGCTTCGGG - Intergenic
1191150707 X:57219091-57219113 TGGCCTCTTTCTCAATCTTCAGG - Intergenic
1191151520 X:57224629-57224651 TAGCTTCTTTCTTGATCTTCAGG - Intergenic
1192057511 X:67787357-67787379 CAGCCTCTTTCTCTATAATCAGG + Intergenic
1192281956 X:69697248-69697270 CGGCCTCTCTCTCAGTCTTCAGG + Intronic
1192282967 X:69703657-69703679 CGGCCTCTCTCTCGGTCTTCAGG + Intronic
1192945681 X:75963872-75963894 TGGCCTCTTTCTCGATCTTCAGG + Intergenic
1192946552 X:75969615-75969637 TGTCCTCTTTCTTGATCTTCAGG + Intergenic
1193520765 X:82526436-82526458 CTTTCTCTTTCTCTATCTTCTGG - Intergenic
1193911991 X:87317198-87317220 CAGCCTCTTTCTCCATCTTCCGG + Intergenic
1194583307 X:95702791-95702813 CTCCCTCTTTCTCTATCTTTTGG + Intergenic
1196477786 X:116108862-116108884 TTGCCTCTTTCTCTATCTTTTGG + Intergenic
1197142587 X:123132687-123132709 TGGCCTCTTTCTCGATCTTCAGG - Intergenic
1197947063 X:131851095-131851117 CGGCCTCTTTCTCAATCTTCAGG + Intergenic
1198012612 X:132574092-132574114 CTGCATCTCTCTCTATCTTCAGG - Intergenic
1198016940 X:132620846-132620868 CAGCCTCTTTCTTGATCACCGGG - Intergenic