ID: 989595180

View in Genome Browser
Species Human (GRCh38)
Location 5:43150064-43150086
Sequence CCCTGTCCCCCTAGTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989595178_989595180 3 Left 989595178 5:43150038-43150060 CCATGTTTGTATCAGTGTTTCTT 0: 1
1: 0
2: 2
3: 39
4: 446
Right 989595180 5:43150064-43150086 CCCTGTCCCCCTAGTCCCACAGG 0: 1
1: 0
2: 1
3: 36
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989595180 Original CRISPR CCCTGTCCCCCTAGTCCCAC AGG Intronic
900646146 1:3709557-3709579 CCTGGTCCCCCTTGCCCCACAGG - Intronic
900998945 1:6137916-6137938 CACTGTCCCCCTACTCCCCCTGG + Intronic
902383066 1:16061639-16061661 CCCTGCCCACCTGGTCCCACTGG - Intronic
903446301 1:23424649-23424671 CCCTGTGCCCCTCGCCCCGCCGG - Exonic
904842104 1:33379367-33379389 CCCTGTCCCCCCCTTCCCCCCGG + Intronic
904844571 1:33399709-33399731 CCCTGTCCCTCTAGTAGCACCGG - Intronic
904903616 1:33877371-33877393 ACTTGTCCCCCTTGTCGCACTGG + Intronic
905975315 1:42170010-42170032 CTCAGTCCCCCCATTCCCACAGG + Intergenic
906541402 1:46589297-46589319 CCCTGTCCCACTCATCCCTCAGG - Intronic
912005595 1:104896109-104896131 CCCATTCCCCCTTTTCCCACTGG - Intergenic
914850348 1:151309558-151309580 CCCTGACCCTTTGGTCCCACAGG - Intronic
915562017 1:156693054-156693076 CCCTGTCCCCCTTTTTCCTCAGG + Intergenic
917455126 1:175179568-175179590 CCCTCACCCCCTATTCCCAAGGG - Intronic
1063665507 10:8058283-8058305 CCCTTTCCCCGTTGCCCCACAGG + Exonic
1064060803 10:12135144-12135166 CCCTTTCCCCCTACCCCCACAGG - Intronic
1064567788 10:16660283-16660305 CCCTGCTCCCCAAGTCCCATGGG - Intronic
1065916180 10:30356460-30356482 ACCTGCACCCCTAGTGCCACAGG - Intronic
1065971089 10:30806521-30806543 CCCTGACCACCCACTCCCACCGG + Intergenic
1067307626 10:45079687-45079709 CCCTCTGCCCCTAAACCCACTGG - Intergenic
1067726642 10:48775594-48775616 CCCTGACCTCCCAGCCCCACTGG - Intronic
1070550440 10:77486853-77486875 CCCTTCCTCCCTAGTCCCCCAGG + Intronic
1070813826 10:79311387-79311409 TCCTGTCCCCCCAGTCCCTTTGG + Intronic
1071471760 10:85988530-85988552 CCTAGTCCCCCTAGGCCCAGGGG - Intronic
1072825475 10:98601799-98601821 CCCTGGCCACCGAGTCCCACAGG - Intronic
1073289074 10:102404550-102404572 CTCTGTCCACCTAGTGCCAGTGG - Intronic
1077106902 11:846089-846111 CCCTGGCCCCCCAGGCCCACGGG - Intronic
1077129005 11:960137-960159 GCCTGTCCCTCCAGTTCCACAGG - Intronic
1077413053 11:2412375-2412397 CAGTGGACCCCTAGTCCCACTGG - Intronic
1077855905 11:6124611-6124633 CCCTTTAGCCCTAGTCCCAGGGG - Intergenic
1079129415 11:17738612-17738634 CCCTGGCCCTCTCCTCCCACTGG + Intronic
1080243660 11:30155623-30155645 CTCTGTCCCCGTAGGCCTACTGG - Intergenic
1081026238 11:38018930-38018952 ACCTGTTCCCCTAAACCCACTGG - Intergenic
1081964310 11:47160477-47160499 CCCTGTTCCCTTAGTCCCCAGGG + Intronic
1083997185 11:66278338-66278360 CCACGTCCCCCGAGCCCCACGGG + Exonic
1084000769 11:66294353-66294375 CCCTGTGCCGCGAGTCGCACTGG + Exonic
1084512986 11:69617637-69617659 CCCAGTGCCCCTCGTCCCCCAGG - Intergenic
1085788215 11:79473470-79473492 CCCTTTCCCCCTGGAACCACAGG - Intergenic
1088338711 11:108738872-108738894 CCCTGCCCCTCAAGTCCCACAGG + Intronic
1088919554 11:114251223-114251245 TCCTGTCCTCCAAGTCCCAGGGG + Intergenic
1089058938 11:115610238-115610260 CCCTTTCCCCCCCTTCCCACAGG + Intergenic
1090433724 11:126668471-126668493 CCCTTTCCCCACAGTCCAACCGG + Intronic
1090725400 11:129521235-129521257 CTCTGGCCCCCAAATCCCACGGG + Intergenic
1091143844 11:133260110-133260132 CTCTGTCCCCCGAGAGCCACAGG - Intronic
1094093911 12:26682221-26682243 CCCTGTTCCCAAAGCCCCACTGG + Intronic
1095985611 12:47997616-47997638 CCCGGCCCCCCTGGTCCCCCTGG - Exonic
1098651566 12:72977195-72977217 CCCTGTCCCCTAAATCCCATGGG + Intergenic
1099163747 12:79275859-79275881 CTCTGCCACCCTAGCCCCACAGG + Intronic
1101919687 12:108922363-108922385 CCCTTGCCCCCAAGTCCCATGGG - Intronic
1102027018 12:109719453-109719475 CCCTGTCGCCCGTGTCCCAGTGG + Intronic
1104461758 12:128962130-128962152 CCCTGTCCCCCTCGGCCTCCTGG + Intronic
1105500900 13:20970890-20970912 CCCTTGTTCCCTAGTCCCACCGG + Intergenic
1107527087 13:41243512-41243534 CCCTGAGCCCAGAGTCCCACAGG - Intronic
1108543621 13:51468398-51468420 CCCTAACCCCCAATTCCCACAGG - Intergenic
1110188055 13:72698398-72698420 CCTTGTCCTCCAAGTCCCATAGG + Intergenic
1110318754 13:74136215-74136237 CCCTCACCCCCGAGTCCCACTGG - Intergenic
1110601998 13:77386197-77386219 CCCTATCCCTCAAGTCCCATGGG - Intergenic
1111578566 13:90191567-90191589 CCCTTTCTTCCTAGTTCCACTGG + Intergenic
1113635161 13:111914442-111914464 TCCTTTCCCCCTGGTCCTACAGG - Intergenic
1114658705 14:24331409-24331431 CCCTGTCCCCCAAATCACTCAGG + Intronic
1114674752 14:24432395-24432417 CCCTGTCCCCCACGTCTCCCCGG - Exonic
1116125399 14:40777608-40777630 CCCTTTCCCCCAAGTCCCCAAGG - Intergenic
1118984750 14:70744189-70744211 CCCTAGCCCCCCACTCCCACAGG - Intronic
1119411156 14:74431351-74431373 CCCTGCCTCCCCAGACCCACAGG - Intergenic
1122294824 14:100699463-100699485 CCATGACCCCCTCTTCCCACTGG - Intergenic
1122658737 14:103279882-103279904 CCTTGTTCCCCAAGACCCACGGG + Intergenic
1122913307 14:104844192-104844214 CCTAGTACCCCTAGTCCCCCAGG + Intergenic
1125755049 15:42057897-42057919 CTCTGTCCCCCTTCACCCACTGG + Intergenic
1127689722 15:61383585-61383607 CCCATGCCCCCAAGTCCCACGGG - Intergenic
1128899183 15:71403808-71403830 CCCTTGCCCCCAAGTCCCATAGG - Intronic
1130303950 15:82700340-82700362 CCTTGGCCCTCTTGTCCCACTGG + Intronic
1131624863 15:94106920-94106942 CCTTGTCCACCAAGTCCCATGGG + Intergenic
1132350839 15:101138901-101138923 GGAGGTCCCCCTAGTCCCACAGG + Intergenic
1132884499 16:2176670-2176692 GCCTGTCCACCTATGCCCACGGG - Exonic
1133423297 16:5665545-5665567 CCCTGACCAGCTAGTGCCACAGG + Intergenic
1134059810 16:11192331-11192353 CCCTCTCCCCCCAGTCCTCCAGG - Intergenic
1136343651 16:29661807-29661829 CCCCTTACCCCAAGTCCCACGGG - Intergenic
1136533696 16:30886836-30886858 CCCAGGCCCCCAAGTCCCTCTGG + Intronic
1137494469 16:48959130-48959152 CCTTGACTCCCTAGTCCCAGTGG - Intergenic
1137837391 16:51606056-51606078 CCCTGACTCCCTTGTCCAACTGG + Intergenic
1138590261 16:57995860-57995882 CCCCTTCCCCCTGGGCCCACTGG + Exonic
1140469161 16:75205043-75205065 CCGAGGCCCCCTTGTCCCACAGG - Intronic
1140472623 16:75223896-75223918 CCGAGGCCCCCTTGTCCCACAGG + Intronic
1141515315 16:84540259-84540281 CCCTTGTCCCCAAGTCCCACAGG + Intronic
1142227745 16:88885728-88885750 CCCTGTCCTCCTAGGCTCCCCGG + Intronic
1142567791 17:852041-852063 CCCTGCCACCCTAATCCCTCAGG + Intronic
1142686889 17:1582446-1582468 CCCTGTCACCAGAGTCTCACGGG - Intronic
1143457973 17:7080011-7080033 CCCTGTCCCCTGGGTCTCACCGG + Intronic
1143479212 17:7219017-7219039 CCCTGGCCCCCTCTTCCCATAGG + Exonic
1146260332 17:31416513-31416535 GCCTGTGCCCTTTGTCCCACCGG + Intronic
1147210212 17:38868969-38868991 CCCTGTCTCCCTACCCCCATTGG + Intergenic
1148739833 17:49886514-49886536 CCCTGCCCCCCTCCACCCACGGG + Intergenic
1149015262 17:51901543-51901565 CACTGACACCCTACTCCCACTGG - Intronic
1150647099 17:66985741-66985763 CTCTGTCTCCCTTCTCCCACTGG - Intronic
1151010740 17:70492706-70492728 CCTTTTCCCCCAAGTCCCCCAGG - Intergenic
1152262237 17:79273485-79273507 CCCTGTGCCCAGAGTCCCAGTGG + Intronic
1153845871 18:9049473-9049495 CCTTGCCCACCAAGTCCCACAGG + Intergenic
1157110292 18:44814133-44814155 CCCCATCACCCTACTCCCACTGG - Intronic
1157286350 18:46379893-46379915 CCCTGGCCTCCTTGGCCCACTGG + Intronic
1159539081 18:69752808-69752830 CCCTGGTCCCCTGGTCCCACGGG + Intronic
1160393357 18:78554309-78554331 CCCTCTCCCCCTACAACCACTGG - Intergenic
1160463863 18:79059414-79059436 CCCTCTCCCACTGGACCCACTGG + Intergenic
1161155505 19:2730407-2730429 CCCTGTCCCCCGAATCCCGCAGG - Intronic
1161246459 19:3255142-3255164 CCCCATCCCCCTAGACCCAATGG + Intronic
1161296529 19:3523173-3523195 CCCAGTCCCCCAGGTCACACGGG + Intronic
1161524043 19:4742646-4742668 TCCTGTCCCCCTAGGTCCCCTGG - Intergenic
1162217784 19:9150551-9150573 CCCTCTCCCCCATCTCCCACAGG - Intronic
1163690342 19:18735267-18735289 CCCTGTCTCCCTTCTCACACTGG + Intronic
1163754872 19:19100731-19100753 TCCTGTCCCCGTGGTGCCACTGG - Intronic
1164015513 19:21253366-21253388 CCCTGGGGCTCTAGTCCCACAGG - Intronic
1166074346 19:40404991-40405013 CCCTGTCCCCCCAATCCCAGAGG - Intronic
1166331554 19:42080712-42080734 CCCTGCCCCTCGAGCCCCACGGG + Exonic
1166567257 19:43772763-43772785 CCCTGACACCCCAGACCCACCGG + Intronic
1166840425 19:45693578-45693600 CCCTGACCCCCTAGCCCTCCAGG + Intronic
1166980923 19:46631639-46631661 CCCTGTCCCCCGTCTCCCCCGGG + Intergenic
1167772617 19:51530630-51530652 CCCTGTCCCCCCACACCCTCAGG + Intronic
1168153476 19:54461058-54461080 CCCTGCCCCCGTTTTCCCACCGG + Exonic
1168315614 19:55483528-55483550 CCCTGCACCCCTAGACCCCCAGG - Exonic
1168636109 19:57998847-57998869 CCCTGTCCCCATAATCACAAAGG + Intronic
931572193 2:63680664-63680686 ACATGTCCCCCAAGTCCCACTGG - Intronic
932369817 2:71177672-71177694 CCCAGACCCCATAGTCCCTCTGG - Intergenic
933676918 2:85065215-85065237 CCTTGTGTCCCTCGTCCCACAGG - Intergenic
933725398 2:85424075-85424097 TCCTGTCCCCCTATTTCCTCAGG + Intronic
934978459 2:98822343-98822365 CCCTGTCCCCCGAGTCCTGAGGG + Exonic
935455747 2:103265939-103265961 CCCCGTCCCCCAACTCCCTCGGG - Intergenic
937456308 2:122044523-122044545 CCCTGGCCCCCTAGTCTATCAGG - Intergenic
938794508 2:134706523-134706545 CCCTTCCCCCATAGCCCCACGGG - Intronic
940330083 2:152465188-152465210 CCCTGTCCCACTAGTCAGAGGGG - Intronic
946310671 2:218880931-218880953 CCCTGGCTCTCCAGTCCCACTGG + Exonic
946395408 2:219441782-219441804 TCCTGTCCCCCTACTTCCCCCGG - Intronic
1169298633 20:4422801-4422823 CCCAGTCAGCCTAGTCCCAAGGG - Intergenic
1169496819 20:6123274-6123296 CCCTGTTCCCCCAGGCCCGCCGG + Exonic
1171249711 20:23638268-23638290 CCCTGGCCCCCCAGTCTCCCTGG + Intronic
1171483043 20:25468385-25468407 CTCTGTCCCCCGACTCTCACTGG + Intronic
1171483068 20:25468459-25468481 CCCTGTCCCCCGACTGTCACTGG + Intronic
1171483084 20:25468496-25468518 CCCTGTCCCCCGACTCTCACTGG + Intronic
1171483094 20:25468533-25468555 CCCTGTCCCCCGACTCTCACTGG + Intronic
1171483127 20:25468640-25468662 CCCTGTCCCCCAATTCTCACTGG + Intronic
1171483160 20:25468747-25468769 CCCTGTCCCCCGACTCTCACTGG + Intronic
1171483196 20:25468857-25468879 CCCTGTCCCCCGACTCTCACTGG + Intronic
1171483226 20:25468968-25468990 CCCTGTCCCCTGACTCTCACTGG + Intronic
1171483237 20:25469005-25469027 CCCTGTCTCCCGACTCTCACTGG + Intronic
1171483247 20:25469042-25469064 CCCTGTCCCCCAACTCTCACTGG + Intronic
1171483259 20:25469079-25469101 CCCTGTCCCCTGACTCTCACTGG + Intronic
1171483270 20:25469116-25469138 CCCTGTCCCCTGACTCTCACTGG + Intronic
1171483281 20:25469153-25469175 CCCTGTCCCTCGACTCTCACTGG + Intronic
1171483289 20:25469190-25469212 CCCTGTCCCCCGACTCTCACTGG + Intronic
1171483325 20:25469300-25469322 CCCTGTCCCCCGACTCTCACTGG + Intronic
1171483336 20:25469337-25469359 CCCTGTCCCCCGACTTTCACTGG + Intronic
1171483368 20:25469440-25469462 CCCTGTCCCCTGACTCTCACTGG + Intronic
1172332397 20:34084381-34084403 CTCTGTCCCTCTATTCTCACAGG - Intronic
1173435194 20:43026066-43026088 CCTTATCCCCCTAGTGCCTCAGG + Intronic
1175086328 20:56462134-56462156 CCATGTCCTCCAAGTCCCAGGGG + Intergenic
1175433794 20:58928160-58928182 ATCTGTCCCCCTACTCCCACTGG - Intergenic
1175519109 20:59588400-59588422 CCCCGTCCCCCTGGTCCCTGGGG + Intronic
1175906559 20:62382767-62382789 CCCTTTCCCACGAGACCCACTGG + Intergenic
1176179642 20:63743233-63743255 CGCTGTCCCCTTAGCCCCAAGGG + Exonic
1178822005 21:35983865-35983887 CCTTGCCCCTCAAGTCCCACAGG - Intronic
1179886793 21:44317668-44317690 CCCTGAGCCCGTATTCCCACTGG + Intronic
1180077341 21:45469381-45469403 CCCTGAGCCCCTGGTCCCAGCGG - Intronic
1180958589 22:19752071-19752093 CCCGGTCCCCCTCTGCCCACGGG + Intergenic
1181968733 22:26674312-26674334 CCCTGCCCCTCTACTCCCAAAGG - Intergenic
1182517770 22:30868708-30868730 CCCTGTCCCCCTCTGGCCACAGG - Intronic
1182692054 22:32171092-32171114 CCCTATCCCCCAAGTATCACCGG - Intergenic
1182919392 22:34065489-34065511 TCCTGGCTCCCTAGTCCCCCAGG + Intergenic
1183523223 22:38308695-38308717 CCCTCTTCCCCTCCTCCCACTGG - Intronic
1183600267 22:38835874-38835896 CCCTGTCCCCAGAGTTCCACGGG + Intronic
1184769187 22:46587957-46587979 CCCTGGCCCCCTGGACCCTCAGG - Intronic
1185270992 22:49929304-49929326 CCCCGTCCCCCGTGTCCCGCGGG - Intergenic
951238022 3:20257608-20257630 CCCTTTCCCCCTACTCCCTAAGG + Intergenic
954092071 3:48292974-48292996 CCTTGCCCTCCAAGTCCCACAGG - Intronic
955654117 3:61226130-61226152 CCCTGTGCCCCTAGTCCCATGGG + Intronic
957129598 3:76206031-76206053 GGCTGTCCCTCTAGTCCCCCTGG + Intronic
961025651 3:123553720-123553742 CCATGTCCCCCAAGTCCCATGGG - Intronic
962650141 3:137480210-137480232 CCCTGTGCCCCTAGATCCCCTGG + Intergenic
966172195 3:177094804-177094826 CCCTTTCCCCCTAGTCCACAAGG - Intronic
966892465 3:184417344-184417366 CCCTGTCGCCCAAGGCCCAGAGG + Intronic
967914471 3:194568295-194568317 CCCAGTCCCCACAGTCACACAGG - Intergenic
970991081 4:22214056-22214078 ACCTGTGCCCCTAGTCACAAGGG + Intergenic
971235714 4:24840242-24840264 CACTGTCCACCCAGTCCCAATGG - Intronic
972312971 4:37898628-37898650 CCCTGACCCCCAATTCCCACAGG - Intronic
973087574 4:46086195-46086217 CCCTGAACCTCTAATCCCACTGG - Intronic
976244115 4:82990377-82990399 CCATATCCCCCAAGTCCCGCAGG + Intronic
977614652 4:99074713-99074735 CCCTCCCCCCCAAGTCCCAGGGG + Intronic
978757868 4:112323908-112323930 TCATGTCCTCCAAGTCCCACTGG + Intronic
979466868 4:121049440-121049462 CCCTGACCCCCACTTCCCACAGG - Intronic
981056114 4:140363145-140363167 CTATGTCCCCCAAGTCCCACAGG - Intronic
981574318 4:146188390-146188412 CCCTGCCCCCCAAGTCCTAGGGG - Intronic
982121892 4:152150830-152150852 CCCTTTCCACCTAGTCCCCAGGG - Intergenic
983871385 4:172828358-172828380 CCCTGCACCCCACGTCCCACAGG + Intronic
985546902 5:514449-514471 CCCTGCCCCCCGAGGCCCATCGG + Intronic
985881325 5:2641014-2641036 CCCTGTCAGCCTAGTCCCTTAGG + Intergenic
986383140 5:7206516-7206538 CCCTGTCCCCCTCTTCCAACAGG - Intergenic
987815308 5:22893287-22893309 CCCTGTGCCCTTAGTCACTCAGG - Intergenic
988102858 5:26704735-26704757 CCCTCTCCCTCTTGTCCCACTGG - Intergenic
989082188 5:37634829-37634851 CCCTGTCCCCCGACTTCCATGGG - Intronic
989595180 5:43150064-43150086 CCCTGTCCCCCTAGTCCCACAGG + Intronic
992074933 5:73183707-73183729 CCCTGGCCCCCTGGTTCCTCTGG + Intergenic
994159723 5:96543375-96543397 CCTTGCCCCCCAAGCCCCACAGG - Intronic
995994316 5:118282007-118282029 CCCTGTCTCCCTCTCCCCACGGG + Intergenic
996950871 5:129124521-129124543 CCTTGCCCCCCAAGTCCCATGGG + Intergenic
997506020 5:134417718-134417740 CCTTGTCCACCAAGTCCCACAGG + Intergenic
999037273 5:148366321-148366343 GCCTGTCCCCCTATTCCCTCAGG - Intergenic
1000485238 5:161833599-161833621 CCCTTTACCCCAATTCCCACAGG + Intergenic
1001747303 5:174101460-174101482 CCCAGACCCCCTAGTCCTAGCGG + Intronic
1003623546 6:7723508-7723530 TCCTGTCCCCTTTGTCCCAATGG + Intergenic
1005894186 6:30163897-30163919 CCCTGTGCCCCTGGGCCCGCTGG + Exonic
1006030791 6:31175296-31175318 CCCTGTCCCGCTAGCCCCCTTGG - Intronic
1006317087 6:33297590-33297612 CCCTTTCACCCTGGTCCCTCGGG + Intronic
1007392603 6:41558722-41558744 CCCTGGCCCCAGAGGCCCACTGG - Intronic
1010637916 6:78283327-78283349 CCCTGTCCCCAAAAACCCACAGG - Intergenic
1010925181 6:81736024-81736046 CTCTGTCTCCCTTTTCCCACTGG - Intronic
1012158831 6:95856961-95856983 CCCTGCCCCCCTAGTTCTGCTGG - Intergenic
1013615869 6:111842517-111842539 CAATGTCCCCCTATTCACACTGG + Intronic
1014680029 6:124416745-124416767 CCATGTTCCCCTATTCACACAGG - Intronic
1015025280 6:128525070-128525092 CCCTGTCCCTCTTGTCCCCAGGG - Intergenic
1016076847 6:139805525-139805547 CCCTGGCCCCCCATCCCCACAGG - Intergenic
1016224641 6:141720746-141720768 CCCTTGCCCCCAAGTCCCACAGG + Intergenic
1017671252 6:156771468-156771490 CTCTATCCCCATAGTCCCTCTGG + Intergenic
1020003906 7:4771712-4771734 CCCTGACCCCCTGGACACACAGG + Intronic
1020230955 7:6318090-6318112 CCCTCTCCCTCTAGAGCCACTGG - Intergenic
1020738507 7:11983733-11983755 CACTGTCCCACCAGGCCCACAGG + Intergenic
1022327034 7:29341817-29341839 CCCTATGACCCTAGTCCCATAGG - Intronic
1022530079 7:31061532-31061554 CCCTGTCCTCCCTGACCCACAGG + Intronic
1024116371 7:46197527-46197549 CCCTGTCCCCATAGTTTCCCTGG + Intergenic
1024498103 7:50070513-50070535 CCCTGGGGCTCTAGTCCCACAGG + Intronic
1026305132 7:69134109-69134131 TTCTGTCCCCCTCTTCCCACAGG + Intergenic
1026866380 7:73826572-73826594 CCCTGTCCCCAGAGTTCCAGGGG - Intronic
1028774941 7:94665521-94665543 CCTTGTCCGTCTCGTCCCACTGG - Exonic
1029114608 7:98230800-98230822 CCCAGGCCCCCAAGTCCCCCTGG - Intronic
1029180027 7:98693669-98693691 CCCTGTCCTCTTGGTCCTACAGG - Intergenic
1029404490 7:100366513-100366535 CCCTGCCCCTCTTGTCCCCCTGG - Intronic
1030821733 7:114101089-114101111 TCTTGTCCCCCAAGTCCCACAGG + Intronic
1032410271 7:131689380-131689402 TCCTGTCCACCCAGTCCCCCAGG - Intergenic
1032671082 7:134082974-134082996 CCCTGTCCCCTCAGTAACACTGG - Intergenic
1033756041 7:144398949-144398971 CCTTGTCCCCCAGGACCCACAGG + Exonic
1035168569 7:157005663-157005685 CACTGTCCCTCAAGTCCCGCAGG + Exonic
1036176887 8:6547780-6547802 CCCTGGCCCCGCATTCCCACCGG - Intronic
1037816727 8:22116477-22116499 CCCTGTCCCCCTGGTCCCTGAGG + Intronic
1042534017 8:69840889-69840911 CCATGCCCCACAAGTCCCACAGG - Intergenic
1044494965 8:92866397-92866419 CTCTGTCACCCTAGGCCCACTGG - Intergenic
1045018552 8:98020794-98020816 CCCTGTCTTCCTTGTCTCACAGG + Intronic
1045220251 8:100192079-100192101 CCCTTGCTCCCAAGTCCCACAGG + Intronic
1049156293 8:141068794-141068816 CCCAGTGCCCCTAGTCCCCAAGG + Intergenic
1049220019 8:141424875-141424897 CCCTGTCCCCTCAGTCCCCTGGG - Intronic
1049835715 8:144734333-144734355 CCCTGTCCCCCAACTCCAGCGGG + Intronic
1052956018 9:34253879-34253901 CCCTGTCCCCCTAGCACCAATGG + Exonic
1053263541 9:36693622-36693644 CCCTGCCCCCCTACTACCATTGG - Intergenic
1055753833 9:79535690-79535712 CCAAGTCGCCCAAGTCCCACAGG - Intergenic
1056092444 9:83218056-83218078 CCCTGTCACTGTAGTTCCACAGG - Intergenic
1057327412 9:94078002-94078024 CACTTTCACCCTAGTCCCCCTGG + Intronic
1058275651 9:103038191-103038213 CCCTGTCCCCCAACACCCACAGG + Intergenic
1059433121 9:114261497-114261519 CCCTGTCTCCCCAGCCCCACAGG - Intronic
1060177661 9:121509039-121509061 CTCTTACCCCCAAGTCCCACGGG - Intergenic
1060549548 9:124478448-124478470 CCCTGTTCCCCTAGCCCACCAGG + Exonic
1060796353 9:126515056-126515078 GCCTGTGCCCCAAATCCCACGGG + Intergenic
1061418813 9:130462264-130462286 CCCAGGCCCCCCAGTCCCAGTGG + Intronic
1062151302 9:135020575-135020597 CCCTGTCCCCATGGCCCCAGGGG + Intergenic
1190056563 X:47184692-47184714 CCCTGTGCCCCCACCCCCACTGG - Intronic
1191104127 X:56761821-56761843 CCCTCTCTCCCTAGTGCCATAGG + Intergenic
1191615904 X:63168932-63168954 CCCTGTCCCCCTTCTCTCAGGGG - Intergenic
1191620394 X:63209991-63210013 CCCTGTCCCCCTTCTCTCAGGGG + Intergenic
1191794796 X:65009748-65009770 CCTTGCCCCCCAAGTCTCACAGG - Intronic
1191902555 X:66054950-66054972 CCCTTTCCCCTTAGTCCCCATGG - Intergenic
1195697400 X:107677034-107677056 CCCCGTCCTCCTCATCCCACTGG - Intergenic
1196074947 X:111565919-111565941 CCCTGTCCCATTTTTCCCACTGG + Intergenic
1199168018 X:144700466-144700488 CCCTGTCCCCCCTCTGCCACAGG + Intergenic
1199844224 X:151679094-151679116 CCTTGTGCCCCCAGACCCACAGG - Intergenic
1199845005 X:151686439-151686461 TCCTGTGTCCCTAGTTCCACAGG + Intergenic
1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG + Intronic
1200886591 Y:8278109-8278131 CCCTGTCACACTGCTCCCACAGG + Intergenic
1201188977 Y:11430361-11430383 CCCTCTCCCCCCAGTCCCCGTGG + Intergenic
1201277387 Y:12312247-12312269 CCCTGGGGCTCTAGTCCCACAGG - Intergenic
1201571833 Y:15423505-15423527 CCCTGGGGCTCTAGTCCCACAGG - Intergenic
1201755951 Y:17485186-17485208 CCCTGGGGCTCTAGTCCCACAGG + Intergenic
1201845601 Y:18420799-18420821 CCCTGGGGCTCTAGTCCCACAGG - Intergenic