ID: 989595180

View in Genome Browser
Species Human (GRCh38)
Location 5:43150064-43150086
Sequence CCCTGTCCCCCTAGTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989595178_989595180 3 Left 989595178 5:43150038-43150060 CCATGTTTGTATCAGTGTTTCTT No data
Right 989595180 5:43150064-43150086 CCCTGTCCCCCTAGTCCCACAGG 0: 1
1: 0
2: 1
3: 36
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989595180 Original CRISPR CCCTGTCCCCCTAGTCCCAC AGG Intronic