ID: 989598009

View in Genome Browser
Species Human (GRCh38)
Location 5:43175065-43175087
Sequence TCTGCTTCAGAATCCACTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989598009_989598011 -6 Left 989598009 5:43175065-43175087 CCAACAGTGGATTCTGAAGCAGA 0: 1
1: 1
2: 1
3: 35
4: 299
Right 989598011 5:43175082-43175104 AGCAGAAAAGGCAGAGAATGAGG 0: 1
1: 2
2: 11
3: 104
4: 923

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989598009 Original CRISPR TCTGCTTCAGAATCCACTGT TGG (reversed) Exonic