ID: 989598924

View in Genome Browser
Species Human (GRCh38)
Location 5:43183738-43183760
Sequence ATGATGTCCTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 2, 1: 0, 2: 1, 3: 14, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989598922_989598924 15 Left 989598922 5:43183700-43183722 CCTTTTTTACTCTAAACTATGGA 0: 1
1: 1
2: 9
3: 54
4: 265
Right 989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG 0: 2
1: 0
2: 1
3: 14
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989598924 Original CRISPR ATGATGTCCTAGAAGAGTGA AGG Intronic
901517822 1:9761149-9761171 ATGATCTCCTAGGGGAATGAAGG - Intronic
902543710 1:17173029-17173051 GGGATGTCCCAGAAGAGAGAGGG - Intergenic
902609199 1:17587445-17587467 CTGATCTCCTGGAAGAGAGAAGG - Exonic
902654801 1:17859837-17859859 ATTATGTCCAAGAACAGAGAAGG + Intergenic
904285404 1:29450383-29450405 ATTATGGCCTGGCAGAGTGATGG + Intergenic
907289353 1:53402947-53402969 CCCATGTCCAAGAAGAGTGAGGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910324192 1:85985734-85985756 ATGAGGTCATTGAAGAGTCAGGG + Intronic
911337852 1:96602692-96602714 AGGATGCCCAAGAAGGGTGAAGG - Intergenic
911653250 1:100413560-100413582 GTGATCTCCTCGAAGAGAGAAGG - Intronic
912213932 1:107585671-107585693 GTGATGTCCTATAAAAGTCATGG + Intronic
913319308 1:117577308-117577330 AAAATGTCCTACAACAGTGATGG + Intergenic
913399902 1:118420476-118420498 ATGTTGACCTAGAAAATTGATGG + Intergenic
914248614 1:145903991-145904013 ATGAAGGCTTAGAAGAGTTAGGG - Intronic
917174659 1:172220142-172220164 ATGATGTCATTGAAGAGAAAGGG + Intronic
917193544 1:172443845-172443867 ATGGGGTGCCAGAAGAGTGAAGG - Exonic
918147909 1:181774089-181774111 ATTCTGTCCTTGAAGGGTGATGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
922059038 1:222069848-222069870 ATAATGTGCTAGAATAGTCAAGG + Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
923928007 1:238658098-238658120 ATCATATCCCAGAAGAGTGAAGG + Intergenic
1063190247 10:3686967-3686989 CTGATATCCTAGTAGAGAGACGG - Intergenic
1065171201 10:23031621-23031643 CTGATGTCCTTGAGAAGTGATGG + Intronic
1066105385 10:32151914-32151936 ATGCTGTAATAGAAGAGGGAAGG - Intergenic
1066528579 10:36310163-36310185 ATGCTGCCCTAGCAGAATGATGG + Intergenic
1069334582 10:67333205-67333227 ATGATGACCTAGTGCAGTGAAGG - Intronic
1070473639 10:76810802-76810824 AAGATCACCTAGTAGAGTGAGGG - Intergenic
1071177389 10:82942202-82942224 ATGATCTCCTACATGTGTGAGGG - Intronic
1071706287 10:88002774-88002796 ATGAAGTATTAGAAGAGAGATGG + Intergenic
1074156637 10:110805739-110805761 ATGCAGTCCTAGAAAAGTGCTGG - Intronic
1074517201 10:114181138-114181160 CTGATGTACTAGAAGAGTAGTGG - Intronic
1075035679 10:119065111-119065133 ATGATGGGCAAGAAGAGTCATGG - Intronic
1077134460 11:991638-991660 ATGATGCCCTGGAAGTGTCACGG + Intronic
1077892954 11:6432432-6432454 ATGAGGTGGTGGAAGAGTGAGGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078969011 11:16384363-16384385 ATGACATCCTAGAAGAATAAAGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083684918 11:64370210-64370232 ATCATGTACTAGGAGGGTGAGGG - Exonic
1083996826 11:66277023-66277045 AGGAGGTGCTAGCAGAGTGAGGG - Exonic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1085868191 11:80319621-80319643 ATGTTTTCCTGGAAGAGAGATGG - Intergenic
1087213404 11:95467430-95467452 CTGATGTCCAGGGAGAGTGAGGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088820151 11:113449609-113449631 ATGCTGGGCTAGCAGAGTGACGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092669740 12:10849302-10849324 CTGAGGCCCTAGAAGAGTCATGG + Intronic
1093128948 12:15366338-15366360 ATGGTGCCCTAGCTGAGTGAGGG + Intronic
1093894469 12:24561831-24561853 CTGATATCCTAGAAGGGTTAAGG + Intergenic
1097043373 12:56169787-56169809 AAGGAGTCCGAGAAGAGTGATGG - Exonic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097318957 12:58204510-58204532 ATGATCACCTTGAAGAGTTAAGG - Intergenic
1097959337 12:65517251-65517273 ATGATTTCATAGAAGAGGAAAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1099439606 12:82685343-82685365 ATGGTGTCCTAGAACACTGAAGG - Intergenic
1100806855 12:98294482-98294504 AAGATGTCAGAGAAGAGGGATGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102419929 12:112795443-112795465 TTGATGTGCTGAAAGAGTGAAGG + Intronic
1104524998 12:129512878-129512900 ATGAACTCCTAGCAGAATGATGG - Intronic
1106243522 13:27928185-27928207 ATGATGTCTTTGAAGAGTTTAGG + Intergenic
1108020424 13:46122308-46122330 ATGCTGTCCTAGAAGAATAAAGG - Intergenic
1109109788 13:58302228-58302250 ATGATGGCCTAGAAAAGTAGGGG - Intergenic
1110427993 13:75391138-75391160 CTGATGTTGTAGAAGAGAGAGGG - Intronic
1113410382 13:110081186-110081208 ATTATGACCTTGAAGACTGATGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115431981 14:33329672-33329694 ACCCTGTCCTAGAAGGGTGAAGG - Intronic
1116075733 14:40108445-40108467 ATGATGTCCCAGGGCAGTGATGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1127255187 15:57284587-57284609 ATTATTTCAAAGAAGAGTGATGG + Intronic
1127540758 15:59936646-59936668 ATATTGTACTAGAAGAGGGAGGG - Intergenic
1132823550 16:1890452-1890474 CTAATGTTTTAGAAGAGTGATGG - Intergenic
1136360454 16:29776061-29776083 AGGAGGTCCAAGAAGAGGGAAGG - Intergenic
1141358818 16:83375596-83375618 GTTAAGTCCTAGAAGAGAGATGG + Intronic
1141463685 16:84193369-84193391 TTGATGTCTTTGAAGAGTAAGGG + Intronic
1144051179 17:11498386-11498408 AAGATGTCCTTTAAGAGAGAAGG + Intronic
1147620024 17:41860068-41860090 ATGTTCTCTTAAAAGAGTGAAGG - Intronic
1147801343 17:43091248-43091270 ATGACGTCCTAGCTGTGTGAAGG + Intronic
1149038067 17:52157493-52157515 GTGCAGTCCTAGAAGGGTGAAGG - Intronic
1155889976 18:31255599-31255621 ATGGAGTCCTGGAAGAGGGAAGG - Intergenic
1158448179 18:57539471-57539493 ATTATTTTCTAGAACAGTGATGG - Intergenic
1159919665 18:74216105-74216127 ATGATGTTCTGGCAGAGGGAAGG - Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
925803136 2:7621848-7621870 ATGATGTCCTAGATGATTTCTGG + Intergenic
926307953 2:11653116-11653138 ATGAGGTCATAGTGGAGTGAAGG + Intergenic
928471408 2:31580384-31580406 ATGAGGTCCTGGGGGAGTGAAGG + Intronic
928699435 2:33883811-33883833 ATGGAGTCCTACATGAGTGACGG - Intergenic
929061667 2:37930813-37930835 AGGAGGTGCTAGCAGAGTGAGGG + Intronic
929131850 2:38582932-38582954 ATGATGACCTAAAAGAATTAAGG - Intronic
929589671 2:43136623-43136645 CTTATGGCCTAGAAAAGTGAGGG + Intergenic
929974065 2:46615064-46615086 AAGTTCTCCAAGAAGAGTGATGG + Exonic
930336339 2:50052001-50052023 AAAATGTCCTAGAAGAGGGATGG - Intronic
932701817 2:73997405-73997427 CTGAAGCCCTAGAAGAGAGAGGG + Intronic
936075550 2:109399263-109399285 ATTATGTCCTGGAAGAGTCTTGG + Intronic
941316256 2:163996225-163996247 ATAATGTGCAAGAAGAGAGACGG + Intergenic
942161134 2:173188717-173188739 ATGATAACCTAGAAGAGGAAAGG - Intronic
942618581 2:177822358-177822380 ATGATGGCACAGTAGAGTGATGG - Intronic
943847299 2:192668299-192668321 ATGATGTCCTAGAAATGTCTAGG - Intergenic
944398179 2:199293669-199293691 ATGATATGCTACAAGGGTGAAGG + Intronic
945524653 2:210873104-210873126 CTGATTTACTAGAAGAATGAAGG - Intergenic
945735440 2:213593650-213593672 ATGATGACCTAGAAAAGAGAAGG - Intronic
946956891 2:224940681-224940703 CTGCTGTCATAGGAGAGTGATGG - Intronic
947693211 2:232159289-232159311 ATGGTGTCCTGCAAGAGTGGTGG - Intronic
948641472 2:239378352-239378374 ATGATGGCCTGGAAGAGGGAAGG + Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1172143826 20:32742979-32743001 TTGGGGTCCTAGAAGAGGGACGG - Intronic
1173036007 20:39411192-39411214 ATGAAGTCCTAGAAGGTTAATGG + Intergenic
1179297524 21:40077051-40077073 ATGAAGTCACTGAAGAGTGAGGG + Intronic
1179935870 21:44602991-44603013 ATGCTGTCCTAGGACAGTGCTGG + Intronic
1183370403 22:37428496-37428518 ATGCGGTCCTATAAAAGTGATGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
956017718 3:64901620-64901642 GTGATGTCCTAGAACAATCAAGG - Intergenic
958002137 3:87763321-87763343 ATGATGGACTAGAAGAGTCCTGG - Intergenic
960175570 3:114513801-114513823 ATGAAGTGCTAGAAGATGGAAGG - Intronic
960231654 3:115235096-115235118 ATGAGGTCAGAGAAGAGGGAAGG + Intergenic
960611602 3:119559810-119559832 ATGGTGCCCGAGAAGAGTGAGGG + Intergenic
961589335 3:127964309-127964331 ATCATGTGCTTAAAGAGTGAAGG - Intronic
963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG + Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
966507590 3:180724382-180724404 AATATATGCTAGAAGAGTGAGGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968466700 4:755238-755260 GCAATGTCTTAGAAGAGTGATGG - Intronic
970452602 4:16185793-16185815 ATGATGTCCTTGAGGAAGGAGGG - Intronic
971530346 4:27680089-27680111 ATGATGTCCTAGGAAACTGATGG + Intergenic
971549356 4:27930040-27930062 ATGATTTCCGAGAACAGTTATGG + Intergenic
972067942 4:34974949-34974971 ATGATGTCACTGAAGAGAGATGG - Intergenic
972658330 4:41088585-41088607 ATGAGGCCCTGGAAGAGGGAGGG - Intronic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
975079230 4:70255294-70255316 ATGACGTCCTAGAGGTGGGAGGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
980027902 4:127788415-127788437 ATGTTGCCCTAGAAGGGGGAGGG - Intronic
982102688 4:151983682-151983704 ATTATATCATAGAAGTGTGAGGG + Intergenic
982567158 4:156999477-156999499 ATTATTTCCTAGAAGAGTCTAGG - Intergenic
983864091 4:172742767-172742789 ATGATGTCCTAGAAAAATGGTGG - Intronic
985302273 4:188503440-188503462 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302379 4:188504289-188504311 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302462 4:188505015-188505037 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302787 4:188507552-188507574 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302835 4:188507910-188507932 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302853 4:188508030-188508052 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985303030 4:188509421-188509443 ATAAAGTCCTGGAAGAGAGAGGG + Intergenic
985796031 5:1962775-1962797 ATTCTGTCCTAGAGGAGTGTAGG + Intergenic
986131415 5:4935496-4935518 TTGAACTCCTAGTAGAGTGAAGG - Intergenic
988744044 5:34114791-34114813 ATGATGTGTTAGAAGAGAGATGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
989711534 5:44403318-44403340 ATGGTGTCCCAAAAGAGAGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990690179 5:58354977-58354999 ATGAAGTCCCAGAAAATTGATGG - Intergenic
997250042 5:132381548-132381570 TTGATGTCCTAGACAAGTTAGGG - Intronic
998299772 5:141006646-141006668 ATGGTGTCCTGAAAGAGTGGTGG + Intronic
1000288174 5:159846084-159846106 ATGTGGACCTAGAAGAGTCAGGG - Intergenic
1000975086 5:167755927-167755949 ACGTTGCCCTAGAAAAGTGAGGG - Intronic
1006530357 6:34647108-34647130 ATGATGTCCATGAAGAGCCATGG + Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1007635210 6:43295785-43295807 CTGATGTCATTGAAGAATGATGG - Intronic
1008190103 6:48445624-48445646 ATGGTTTCCTAGAAAAGCGAAGG - Intergenic
1008720512 6:54344394-54344416 ATGATGTCCTTGATGTGTCAGGG + Intronic
1009961848 6:70532503-70532525 ATGATTACCTAGAATGGTGATGG + Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012976167 6:105783401-105783423 ATGGAGTGCTAGAAGAGTGCTGG - Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1023995537 7:45157301-45157323 ATGATGGCCTAGAGGAGTCTGGG - Intergenic
1025074396 7:55930378-55930400 AAGATGTCCTAGACCAGTCATGG + Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1032411795 7:131699609-131699631 AAGATGTCCTTCAAAAGTGAAGG + Intergenic
1032574060 7:133033861-133033883 CTGATGTCCTAGAGGGATGAGGG + Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1035934863 8:3825569-3825591 TTGATTACCTAGAAGAGTGGGGG + Intronic
1037124626 8:15332171-15332193 AAAATGGCCTAGTAGAGTGATGG + Intergenic
1039786603 8:40839796-40839818 ATGAAGTCTTGGAAGAGTGAGGG + Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1045181000 8:99782581-99782603 AAGATGTCCAAGCAGAGGGAAGG + Intronic
1047362969 8:124185672-124185694 AGGAAGTCCTTGAAGAATGATGG + Intergenic
1047448549 8:124941868-124941890 ATGGTGCCATAAAAGAGTGAAGG - Intergenic
1048517175 8:135121757-135121779 AAAATATCCTAGAAGTGTGAAGG + Intergenic
1049849218 8:144821794-144821816 AGGGTGTCCTAGAGGAGGGAGGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1055617678 9:78090114-78090136 CTGATGTCATAGAAGAGTGATGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056197685 9:84244524-84244546 AAGATGGACTAGAAGAGGGAAGG - Intergenic
1056436961 9:86583820-86583842 CTGATGTCCTGGACTAGTGAGGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187284044 X:17885890-17885912 AAAATGTCCTGGAAGAGTGGTGG - Intergenic
1188056337 X:25545038-25545060 AAGATTTCCTGGAAGACTGAGGG + Intergenic
1189575801 X:42351932-42351954 ATGAAGACACAGAAGAGTGAGGG - Intergenic
1190049350 X:47138135-47138157 GTGATGTCCTATTAGATTGAAGG + Intergenic
1190325055 X:49201431-49201453 ATGAATTCCTAGAAGTATGAAGG - Intergenic
1191044955 X:56126367-56126389 ATGATATTCTAAAAGAGAGATGG - Intergenic
1192478058 X:71460742-71460764 ATGATGTCCTATGAGGGAGACGG + Exonic
1195771651 X:108357835-108357857 ATGTTGTCCTAGAATAGGGATGG + Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1197117273 X:122848583-122848605 AACATGGGCTAGAAGAGTGAGGG - Intergenic
1200714909 Y:6527222-6527244 ATCATGTAGTAGAAGAGAGAAGG - Intergenic
1201589093 Y:15593836-15593858 GTGCTGTGCTAAAAGAGTGAGGG - Intergenic