ID: 989600175

View in Genome Browser
Species Human (GRCh38)
Location 5:43193170-43193192
Sequence TCAAGCACGCAGAAGCTGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989600175_989600178 -6 Left 989600175 5:43193170-43193192 CCAGCCAGCTTCTGCGTGCTTGA 0: 1
1: 0
2: 2
3: 6
4: 151
Right 989600178 5:43193187-43193209 GCTTGACACATCTTGGCAGATGG 0: 1
1: 0
2: 1
3: 12
4: 137
989600175_989600179 5 Left 989600175 5:43193170-43193192 CCAGCCAGCTTCTGCGTGCTTGA 0: 1
1: 0
2: 2
3: 6
4: 151
Right 989600179 5:43193198-43193220 CTTGGCAGATGGAGAAGTCAAGG 0: 1
1: 0
2: 4
3: 38
4: 373
989600175_989600181 21 Left 989600175 5:43193170-43193192 CCAGCCAGCTTCTGCGTGCTTGA 0: 1
1: 0
2: 2
3: 6
4: 151
Right 989600181 5:43193214-43193236 GTCAAGGCAATAGATAACATGGG 0: 1
1: 0
2: 1
3: 17
4: 135
989600175_989600180 20 Left 989600175 5:43193170-43193192 CCAGCCAGCTTCTGCGTGCTTGA 0: 1
1: 0
2: 2
3: 6
4: 151
Right 989600180 5:43193213-43193235 AGTCAAGGCAATAGATAACATGG 0: 1
1: 0
2: 1
3: 13
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989600175 Original CRISPR TCAAGCACGCAGAAGCTGGC TGG (reversed) Exonic
900357410 1:2271495-2271517 TTAAGCGCTCAGATGCTGGCAGG + Intronic
901759048 1:11458931-11458953 TGAAGCACCCAGAAGCTGGCAGG + Intergenic
902192391 1:14772947-14772969 TCAACTGCGCAGAAGCTGCCTGG - Intronic
914330613 1:146666877-146666899 CCAAGCACACAGAGGCAGGCAGG + Intergenic
915146832 1:153800476-153800498 TCTAGTACGCTGATGCTGGCAGG + Intergenic
917020727 1:170583402-170583424 GCAGGCACGCAGAGGCAGGCAGG + Intergenic
919669646 1:200327309-200327331 TCAAGAAGGCAGCACCTGGCTGG - Intergenic
919796811 1:201325762-201325784 CCAAGGCCGCAGAAGCTGCCCGG + Exonic
920046258 1:203134532-203134554 TCAAGCACTCAGAAACTTCCGGG - Intronic
921603803 1:217134634-217134656 TCAGGCGCGCAGCGGCTGGCTGG - Intronic
921791548 1:219296235-219296257 CCCAGCACGCAGAAGCTCGGTGG - Intergenic
1062961694 10:1577270-1577292 TCATGCACACAGAAGGTGGATGG + Intronic
1064184266 10:13147175-13147197 TCATGGAAGCAGATGCTGGCTGG - Intergenic
1065773555 10:29099653-29099675 GCATGCAGGCAGAAGCTGGCTGG + Intergenic
1066391650 10:34981537-34981559 TGAACCAGGCAGAAGCTGGTAGG + Intergenic
1068396799 10:56472564-56472586 TAAAGCAGGCAGAAACTGGAGGG + Intergenic
1070949370 10:80418657-80418679 CTAAGCACACAGAAGCAGGCTGG + Intronic
1071029467 10:81159051-81159073 TCAAGCAGACAGATTCTGGCTGG - Intergenic
1071503988 10:86222058-86222080 CCAAGAACCCTGAAGCTGGCAGG + Intronic
1073509367 10:104033820-104033842 TCAAGCAGGCAGGGGCTGGAGGG - Intronic
1075278373 10:121116179-121116201 TCAAGCACCTATAATCTGGCAGG - Intergenic
1076264823 10:129101437-129101459 TCAAGCAGGCCGCAGCTCGCTGG - Intergenic
1076346503 10:129782396-129782418 GCAAGAACTCAGAAGCTGGCCGG + Intergenic
1076786042 10:132750626-132750648 GGAATCACGCAGCAGCTGGCTGG + Intronic
1078562988 11:12389461-12389483 CCAAGAACTCAGAAGCTGGGAGG - Intronic
1080098919 11:28436958-28436980 TAAAGCAGGCAGAAGAAGGCGGG + Intergenic
1086064989 11:82734235-82734257 GCAAGCGCCCAGAAGCTGGTGGG - Intergenic
1086466274 11:87056952-87056974 TTAAGTATGCAGAAGATGGCAGG + Intronic
1091546647 12:1505491-1505513 TCAAGAACTCGGAAGCTGGGAGG - Intergenic
1091583075 12:1800420-1800442 TCAAGAAGGCAGAAATTGGCTGG + Exonic
1101334146 12:103781468-103781490 CGAAGCACCCAGCAGCTGGCTGG + Intronic
1104096537 12:125563310-125563332 TAAAGAACGCAGTATCTGGCCGG + Intronic
1104937368 12:132373733-132373755 TCAAGGACGCTGGACCTGGCTGG - Intergenic
1106337426 13:28796419-28796441 TCACGCACAGAGATGCTGGCAGG - Intergenic
1108574264 13:51778063-51778085 TCCAGCTCGCAGGAGCTGCCTGG + Intronic
1112058134 13:95709933-95709955 TCAAAAAGTCAGAAGCTGGCCGG - Intronic
1114646900 14:24260967-24260989 TCAGGCAGGCAGAAGGTGACAGG - Intronic
1115131003 14:30051799-30051821 TAAAGCAGGCAGAAGTTGGAAGG + Intronic
1115470421 14:33763154-33763176 TCAAGCAAGCTGGAGCTGGAGGG - Intronic
1115975904 14:38996623-38996645 TAAAGCAGGCAGAAGATGGAAGG - Intergenic
1121947202 14:98135036-98135058 TGAAACAGGCAGAAGCTGCCAGG + Intergenic
1122514978 14:102301134-102301156 TCATGCACTCAGATGGTGGCTGG - Intronic
1124438814 15:29672530-29672552 TCAAGCAGCCAGAAGCTCCCTGG - Intergenic
1126263753 15:46728265-46728287 TTAATCAAGCAGAAGCTGGAAGG - Intergenic
1128260185 15:66227878-66227900 TGGAGCACCCAGAGGCTGGCTGG - Intronic
1128643826 15:69360410-69360432 TAAAGCCAGCAGCAGCTGGCTGG + Intronic
1132642527 16:984348-984370 CCAAGCACTCTGAGGCTGGCGGG - Intronic
1133978952 16:10619493-10619515 TCAATCCCGCAGAAGCTGGTGGG + Intergenic
1135613103 16:23885779-23885801 TCAGACACGAGGAAGCTGGCGGG + Intronic
1135769237 16:25203878-25203900 TCATCCACCCAGAAGCTGTCTGG - Intergenic
1137543386 16:49379979-49380001 TAAAGCAGGCAGAAGTTGGAAGG + Intronic
1140002941 16:71044029-71044051 CCAAGCACACAGAGGCAGGCAGG - Intronic
1144175917 17:12707407-12707429 AAAAGCACACAGAAGCAGGCTGG + Intronic
1144946440 17:18971818-18971840 TCAGGCACACAGGAGCCGGCAGG + Intronic
1146272690 17:31494771-31494793 TTAAAAACACAGAAGCTGGCTGG - Intronic
1146584042 17:34066684-34066706 TCATGGAGTCAGAAGCTGGCTGG + Intronic
1147151304 17:38516147-38516169 TCAAGAAGGCAGAATCAGGCTGG + Intergenic
1149051073 17:52306206-52306228 TAAAGCAGGCAGAAGTTGGAAGG + Intergenic
1149202196 17:54199862-54199884 TCAAGAATGCACAAGATGGCAGG - Intergenic
1149687129 17:58542445-58542467 TGGAGCACAGAGAAGCTGGCAGG + Intronic
1163167327 19:15507423-15507445 TCAAGCACAGAGAAACTGGAGGG - Intergenic
1163584898 19:18158190-18158212 TCAAGAAGGGAGAAGCGGGCCGG + Intronic
925438969 2:3867572-3867594 TCAAGAACGTAGACACTGGCTGG - Intergenic
927130120 2:20051651-20051673 GCAGGCGCGAAGAAGCTGGCAGG - Exonic
927787539 2:25983768-25983790 TCAAGGAAGCAGGAGCTGTCAGG - Intergenic
928202308 2:29255956-29255978 TCAAGCAGGAAGAATCTGGCAGG + Intronic
929985014 2:46720977-46720999 TCAAGAAAGCAGGAGCAGGCAGG - Intronic
932246101 2:70197903-70197925 TCAAGGAGGCAGAGGCAGGCCGG - Intronic
932340485 2:70960165-70960187 CCAAGCAGGCAGGGGCTGGCAGG + Intronic
933222811 2:79710147-79710169 TTAATCAGGCAGAAGCTGACAGG - Intronic
935965309 2:108466767-108466789 TCAAGAAACCATAAGCTGGCCGG - Intronic
939178541 2:138779929-138779951 TAAAGTAGGCAGAAGGTGGCCGG - Intronic
943401823 2:187421934-187421956 TCAAGCATACAGATGCTGGTGGG + Intronic
944469898 2:200041748-200041770 TCACACAATCAGAAGCTGGCAGG - Intergenic
945037910 2:205720024-205720046 AAAAGGAGGCAGAAGCTGGCTGG - Intronic
947357738 2:229314558-229314580 TCAGGCAAGCAGGAGTTGGCTGG + Intergenic
1169483854 20:6009561-6009583 TCAAGAATACAGAAGATGGCTGG - Intronic
1170697430 20:18671935-18671957 TTAAGAATGCAAAAGCTGGCTGG + Intronic
1170850640 20:20000989-20001011 TCAAGCATGTAGAAGCGGGAAGG - Exonic
1170877162 20:20261315-20261337 ACAAGCAGGCAAATGCTGGCTGG - Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1172880490 20:38196562-38196584 GCAAGCACGCAGAAGCAGCTTGG + Intergenic
1174485229 20:50856743-50856765 TCAGGCACAAAGATGCTGGCAGG - Intronic
1177579841 21:23007536-23007558 TCGAGCTTGCAGAAGCTGGGAGG - Intergenic
1178410626 21:32360767-32360789 CTCAGCACTCAGAAGCTGGCTGG + Intronic
1178531165 21:33377430-33377452 TCATGAATGCAGATGCTGGCTGG + Intergenic
1180055608 21:45357783-45357805 TCAAGCAATCCTAAGCTGGCTGG - Intergenic
1182361831 22:29751133-29751155 TGAAGCTCCCAGAAGCTTGCTGG + Intronic
1183105917 22:35615042-35615064 TCTAGAACACAGAAGCTGGAAGG - Intronic
949852702 3:8434860-8434882 CCAGGCACTCAGAGGCTGGCAGG - Intergenic
950648149 3:14390364-14390386 TCAATCAAGAAGAAGCTGCCAGG - Intergenic
950859251 3:16133014-16133036 TCCAAGAGGCAGAAGCTGGCTGG - Intergenic
951542803 3:23798319-23798341 TCAAGCATGGAGCAGCAGGCAGG - Intergenic
952402234 3:32973910-32973932 TGAAGCAAGCAGCAGCTGCCAGG + Intergenic
952958301 3:38574357-38574379 TTAAGAAGGCAGAAGATGGCCGG - Intronic
953405739 3:42658965-42658987 TCCAGCTTGCACAAGCTGGCTGG - Exonic
957196053 3:77070120-77070142 GCAAGCCCCCAGAAGCTGGGAGG + Intronic
958141249 3:89564979-89565001 TAAAGCAGGCAGAAGTTGGAAGG + Intergenic
966871345 3:184292125-184292147 CCCAGCACGCGGAAGCGGGCAGG - Exonic
968228537 3:196990843-196990865 CCAAGGAGGCAGAAGCTGCCTGG - Intronic
974588609 4:63915734-63915756 TAAAGCAGGCAGAAGTTGGAAGG + Intergenic
977001671 4:91512285-91512307 TAAAGCAGGCAGAAGTTGGAAGG + Intronic
979626417 4:122849963-122849985 TCAAGAATGCAGAAGCTGGCTGG + Intronic
983415173 4:167443289-167443311 TAAAGCAGGCAGAAGTTGGAAGG + Intergenic
985948685 5:3206272-3206294 TGAGGCACCCAGAAGCTGGGGGG - Intergenic
987228515 5:15868622-15868644 TAAAGCACTCAGAAGATGGTTGG + Intronic
989600175 5:43193170-43193192 TCAAGCACGCAGAAGCTGGCTGG - Exonic
992661217 5:78962899-78962921 TCAAACAGGCAGAAACTGGAAGG + Intronic
1000223176 5:159233827-159233849 TAAAGCAGGCAGAAGGTGGTGGG - Intergenic
1000752184 5:165110774-165110796 TAAGGCACAGAGAAGCTGGCTGG - Intergenic
1001141234 5:169145675-169145697 TCCAGAGCCCAGAAGCTGGCAGG - Intronic
1001283571 5:170405978-170406000 TCAAGCCCGGAGAAACGGGCAGG - Intronic
1002476671 5:179470293-179470315 TAATGGACGCAGCAGCTGGCTGG - Intergenic
1002850919 6:995674-995696 TCCCACACCCAGAAGCTGGCAGG - Intergenic
1005219008 6:23564616-23564638 TCAAGCAATCAGAAGCTTTCGGG - Intergenic
1006861278 6:37172929-37172951 ACAAGCACAAAGAAGCTGGGTGG - Intronic
1008092687 6:47309121-47309143 TCAAATGCGCAGAAGCTGGGCGG + Intronic
1008253339 6:49267524-49267546 TCAAGCAACCAGAAGCAAGCAGG - Intergenic
1009711678 6:67330236-67330258 TAAAGCAGGCAGAAGTTGGAAGG + Intergenic
1009929078 6:70154875-70154897 TAAAGCAGGCAGAAGGTGGAAGG - Intronic
1012544099 6:100396573-100396595 TCAAGCAGGCAGAAGTTGGGTGG + Intronic
1015259992 6:131226220-131226242 TAAAGCAGGCAACAGCTGGCAGG - Intronic
1017434110 6:154399560-154399582 TCAAGCAGATAGAAGCAGGCGGG - Exonic
1017495691 6:154981240-154981262 TTAAGCAAGCTGAAGCTGGCTGG + Intronic
1017702759 6:157091489-157091511 TCAAACAAGCAGAATCTGGAAGG + Intronic
1018190763 6:161307464-161307486 TAAAGCAGGCAGAAGGTGGAAGG - Intergenic
1018530225 6:164755166-164755188 TAAAGCAGGCAGAAGTTGGAAGG + Intergenic
1018861795 6:167715888-167715910 TCAGGCATGAAGAAGCTGGAAGG + Intergenic
1019478721 7:1256322-1256344 CCAGGGACGCAGAAGGTGGCTGG - Intergenic
1019707020 7:2501794-2501816 GCAGGTAAGCAGAAGCTGGCAGG - Intergenic
1021080474 7:16358106-16358128 TTACACAGGCAGAAGCTGGCAGG + Intronic
1023846583 7:44124081-44124103 TCCCGGACGCAGACGCTGGCAGG - Intronic
1026125986 7:67579970-67579992 ACAAGCAGGCAGAAGCAGGAGGG - Intergenic
1026877359 7:73887233-73887255 TCACCCACGCAGAGGCAGGCAGG + Intergenic
1032189363 7:129754956-129754978 TCAAGTTCCCAGATGCTGGCTGG - Intronic
1032806273 7:135357843-135357865 TCAAGGGCGCAGAAACTGACAGG + Intergenic
1033238140 7:139654746-139654768 TTAAGCACTCAGAATTTGGCTGG - Intronic
1034224425 7:149471732-149471754 TCCAGCACATGGAAGCTGGCTGG - Intergenic
1036453907 8:8892310-8892332 GCCAGCTCGCAGAAGCCGGCGGG + Exonic
1040417294 8:47206610-47206632 CCAAGCAAGGAGAATCTGGCGGG + Intergenic
1042668684 8:71235455-71235477 TCAAGAAGGGAGAAGCTGGGAGG - Intronic
1044840778 8:96335160-96335182 GGAAGCAGGCAGATGCTGGCTGG - Exonic
1045393709 8:101739568-101739590 TAAAGCAGGCAGAAGTTGGAAGG + Intronic
1045405193 8:101859129-101859151 TAAAGCAGGCAGAAGTTGGAAGG + Intronic
1047451591 8:124969856-124969878 TCAAGAACTCAGGAGTTGGCTGG + Intergenic
1049103404 8:140596284-140596306 TAAAGAAAACAGAAGCTGGCTGG + Intronic
1049349321 8:142155640-142155662 TCAAGTACGAAGAAGCAGGAAGG + Intergenic
1050365551 9:4870397-4870419 TCAAGAATGCAAGAGCTGGCTGG - Intronic
1057230163 9:93317121-93317143 TGAACCACCCAGGAGCTGGCAGG - Intronic
1057819050 9:98317281-98317303 GGAGGCACGCAGAAGCTGCCGGG + Intronic
1058061340 9:100499901-100499923 TCAACCATGAAGAAACTGGCTGG - Intronic
1061812647 9:133171369-133171391 TCAAGCTCGGAGCAGCGGGCTGG - Intergenic
1062270366 9:135705505-135705527 TCAAGGTCACACAAGCTGGCTGG - Intronic
1062306353 9:135908893-135908915 TCGAGAACGCAGGAGCTGGAAGG + Intergenic
1062377430 9:136268465-136268487 TCTAGCACCAAGGAGCTGGCAGG + Intergenic
1186769389 X:12802893-12802915 TCAACCACGCAGAGGCAGGGCGG + Intronic
1187209150 X:17211807-17211829 TCAAGCACTCAGATGATAGCTGG - Intergenic
1188874178 X:35409847-35409869 GCAAGAACACAGATGCTGGCAGG - Intergenic
1192356630 X:70410243-70410265 TCAACCCAGCTGAAGCTGGCTGG + Intronic
1195942019 X:110174750-110174772 TCAAGCAGGCAGGAAGTGGCTGG + Exonic