ID: 989604481

View in Genome Browser
Species Human (GRCh38)
Location 5:43230783-43230805
Sequence TGTGAGGTACAGAATTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989604481 Original CRISPR TGTGAGGTACAGAATTGGGG AGG (reversed) Intronic
901734489 1:11303889-11303911 TATGAGGGACAGAAATGGGGTGG + Intergenic
907464071 1:54623579-54623601 TGTGGGGAAGAGGATTGGGGCGG - Intronic
907573569 1:55506004-55506026 AGTGAGGCAGAGGATTGGGGTGG - Intergenic
911200834 1:95042219-95042241 TGTGAGATAGAGTGTTGGGGTGG - Intronic
913298472 1:117345322-117345344 TGTGAGGTCCAGGATGGGGTCGG - Intergenic
914265300 1:146033464-146033486 GGTGAGATACAGAGTTTGGGGGG - Intergenic
914334305 1:146700926-146700948 TGAGAGGTACAAAACTGGTGAGG - Intergenic
914879322 1:151535563-151535585 TGAGAGGACCAGACTTGGGGAGG - Intronic
916164573 1:161954332-161954354 TGTGGGGTACACAAGTGTGGAGG - Intronic
918063276 1:181080764-181080786 AGTGATGTGCAGAATTTGGGCGG + Intergenic
920559432 1:206928757-206928779 TGTGAGTGACAGAAATGGTGCGG + Exonic
922822619 1:228494492-228494514 TGGGAGGCACAGGAGTGGGGTGG - Exonic
923663202 1:235976911-235976933 TCTGAGGTACAGGATGGGGCTGG - Exonic
923899594 1:238311315-238311337 TATGGGTTACAGAAGTGGGGTGG + Intergenic
924636909 1:245797114-245797136 TGTGAGATACAGAATATGAGGGG + Intronic
1068817285 10:61331827-61331849 TGTCAGGTACAGAGTTGGGATGG - Intergenic
1069659673 10:70115301-70115323 TGTGAGGTAGAGACTTCAGGGGG - Intronic
1069856016 10:71441383-71441405 TGAGTGGAACAGAATGGGGGAGG - Intronic
1069886434 10:71626840-71626862 TGAGAGGTACAGAATGTTGGAGG - Intronic
1070038029 10:72746826-72746848 TATTATGTACTGAATTGGGGAGG + Intronic
1072453743 10:95559472-95559494 TGTGGGGTAAAGAGTTGGGAGGG - Intronic
1072528129 10:96292814-96292836 TGTAAACTACAGAATTTGGGTGG - Intergenic
1074929974 10:118114756-118114778 TGTGAAGTACAAAATCTGGGTGG + Intergenic
1075669899 10:124257120-124257142 TGTGCCGTACAGAAGTGGGTGGG + Intergenic
1080385085 11:31806110-31806132 TGTGAGTTACAGGATTTGGGGGG + Intronic
1081471905 11:43381888-43381910 AAGGAGGTACAGGATTGGGGAGG + Intronic
1082851558 11:57769481-57769503 TGTGAGGAACTGAATGTGGGAGG - Intronic
1083192458 11:61062034-61062056 GGGGTGTTACAGAATTGGGGTGG + Intergenic
1084641758 11:70430477-70430499 TGTGAGGGACAGAGGAGGGGCGG - Intronic
1087252839 11:95923531-95923553 TGTGGGGAAAAGAATGGGGGCGG + Intronic
1087725267 11:101708577-101708599 TGTGAGGACGAGATTTGGGGGGG + Intronic
1089013585 11:115148968-115148990 TGTGGGGTACAGAGTTTGTGTGG + Intergenic
1089662015 11:119991980-119992002 TGTGATGTAGAGATTTGGGATGG + Intergenic
1090000172 11:122949559-122949581 TGGGAGCTGCAGGATTGGGGTGG - Intronic
1091960706 12:4691799-4691821 TGTGAGGGCCAGGATGGGGGGGG + Exonic
1092242807 12:6845858-6845880 TGGGGGGTACAGAATGGGGAGGG - Intronic
1092863376 12:12739066-12739088 TGCAAGGGACAGATTTGGGGAGG + Intronic
1095263959 12:40131910-40131932 TGTGAGGTAAATAACTGTGGAGG - Intergenic
1096009264 12:48198957-48198979 TGTAACGTAGAAAATTGGGGCGG - Intergenic
1096333115 12:50732078-50732100 TCTAAGGTACAGAAATGAGGAGG + Intronic
1096650210 12:53058849-53058871 TGGGAGGTACAGGGTTGTGGCGG + Intronic
1100932529 12:99626602-99626624 TGTGAGGTAAAAGATTGGGGTGG - Intronic
1103291586 12:119850620-119850642 TGTTAGGTAAAGAATTGAGCAGG - Intronic
1103942073 12:124506604-124506626 TGTGAAGTACGCAAGTGGGGAGG - Intronic
1105792745 13:23818613-23818635 TGTGAGGTACAGAAATAGCTGGG + Intronic
1106895699 13:34299812-34299834 TGTGGGGTACAGTATTGGAGAGG - Intergenic
1107721205 13:43250288-43250310 AGTAAGGAACAGACTTGGGGTGG - Intronic
1109661812 13:65469424-65469446 TGAGAGGTAAAGACATGGGGTGG - Intergenic
1111799799 13:92967693-92967715 TGTGGGGCACAGAATTAAGGGGG - Intergenic
1112257750 13:97850280-97850302 TGTGAGTCACAGATTTGGGCAGG - Intergenic
1113036893 13:106060689-106060711 TGTGAGGTACAGAAATGTCAAGG + Intergenic
1116596649 14:46857367-46857389 TGTGAGGTTTAGAATTCAGGCGG + Intronic
1122625572 14:103083970-103083992 TTTGAGGTGCAGAATTCGGTGGG - Intergenic
1124843946 15:33272234-33272256 TGTGAGGCACACACTTTGGGAGG - Intergenic
1130174206 15:81550663-81550685 TGTAGGGTAAAAAATTGGGGGGG + Intergenic
1130278315 15:82495771-82495793 TGTGAGTTACAGATTGGGGCTGG - Intergenic
1130470644 15:84222956-84222978 TGTGAGTTACAGATTGGGGCTGG - Intergenic
1130478132 15:84337523-84337545 TGTGAGTTACAGATTGGGGCTGG - Intergenic
1130493633 15:84450607-84450629 TGTGAGTTACAGATTGGGGCTGG + Intergenic
1130592931 15:85227582-85227604 TGTGAGTTACAGATTGGGGCTGG - Intergenic
1130652785 15:85771778-85771800 AGTGAGGTACAGGATGGAGGTGG - Intronic
1130828255 15:87572041-87572063 TGTTAGGGACATAATTGGGAAGG + Intergenic
1130870209 15:87965568-87965590 CCTGAGGTACACAATTGTGGAGG - Intronic
1132578037 16:672888-672910 TATGAGGTACAGTCCTGGGGTGG - Intronic
1137515852 16:49143491-49143513 TGTGAGATATAGAATAAGGGTGG + Intergenic
1137532855 16:49293493-49293515 TGGTAGGTACAAAAGTGGGGTGG - Intergenic
1137548985 16:49423823-49423845 TGCGAGGTACCGACTTGGGAGGG - Intergenic
1139683425 16:68582921-68582943 TGAGAGGTACAGAAGAGAGGGGG + Intergenic
1140261434 16:73383705-73383727 TGTGAGGGGCAGAGTTGGAGGGG - Intergenic
1141224184 16:82099792-82099814 TATGTAATACAGAATTGGGGTGG - Intergenic
1142281526 16:89150671-89150693 TGTGAGGGACAGGACTGGGCAGG + Intronic
1147417601 17:40304723-40304745 TGTGAGGTCCAGGCTGGGGGTGG + Intergenic
1149705575 17:58691836-58691858 TTTGTGGTACAGACTTGGGAAGG - Intronic
1151554569 17:74840201-74840223 GGTGAGGTACAGAAAGAGGGAGG - Intergenic
1153286645 18:3462203-3462225 TGTCAAGGACAGAAATGGGGTGG - Intergenic
1153408875 18:4771049-4771071 TGAGGGGTAAAGATTTGGGGAGG + Intergenic
1155440033 18:25852406-25852428 AGAGAGGTAGAGATTTGGGGTGG - Intergenic
1155783658 18:29872910-29872932 TGTGAGTTACAGATTTGGAATGG - Intergenic
1157418498 18:47526047-47526069 TGGGATGTACAGGATGGGGGTGG - Intergenic
1159760294 18:72417321-72417343 TGTGAGTTACTGAAATTGGGTGG + Intergenic
1161079830 19:2305274-2305296 TGTGGGGGACAGTTTTGGGGAGG - Intronic
1161875286 19:6903786-6903808 TGTGGGGTACAGAATGGGTGTGG - Intronic
1163133401 19:15291091-15291113 TGTTAGGAACAGGATCGGGGTGG - Intronic
1164030885 19:21403092-21403114 TGTCAGGGACAGAATTGTGTCGG + Intronic
1165402086 19:35607895-35607917 TGTGAGCTACTGAAATGGTGGGG - Intergenic
1165822455 19:38685247-38685269 TGTAGGGTACACAATTTGGGTGG - Intronic
926393705 2:12420154-12420176 TGTAAGGTACAGAGATGGTGTGG + Intergenic
927441869 2:23124560-23124582 TGTATGGAACAGATTTGGGGAGG + Intergenic
927966872 2:27275784-27275806 TCTGAGGGACAGAAGTGGGGTGG + Intronic
928412878 2:31067893-31067915 TGTGACCTACAGTCTTGGGGAGG + Intronic
930249740 2:49021988-49022010 TGAGAGGTACAGAATTGAGAAGG + Intronic
930920824 2:56751674-56751696 TCAGAGGGACAGAATTGGGCAGG - Intergenic
932600668 2:73123019-73123041 TGAGAGGTACAGAAATGAAGGGG - Intronic
933261793 2:80139440-80139462 TGTGATGTACAGAAATGGAAAGG - Intronic
936168415 2:110145240-110145262 TCTGAGGAGCAGAATTGAGGAGG - Intronic
936452458 2:112643942-112643964 TGGGAGGTGAGGAATTGGGGTGG - Intergenic
937067317 2:119027369-119027391 TGTGAAGGACAGGGTTGGGGTGG - Intergenic
938129979 2:128706989-128707011 TGGGAGGTAGATAATGGGGGTGG - Intergenic
944175767 2:196827480-196827502 GGTGGTGTACAGGATTGGGGTGG - Intergenic
944234656 2:197431058-197431080 TCAGAGGGACAGAATTGGTGGGG - Intronic
944958631 2:204842352-204842374 TGTATGCTACAGAATTGAGGTGG + Intronic
946105069 2:217361971-217361993 TGTGAGGAAGAGAATTGGGCAGG + Intronic
946407512 2:219499585-219499607 TGTGAATTTCAGAATTTGGGAGG + Intronic
947753044 2:232542737-232542759 CTTGAGGGACAGAAGTGGGGTGG - Intronic
948349997 2:237332015-237332037 TGTGAGGTTCAGAATTAAGAAGG - Intronic
1168900812 20:1363190-1363212 TGTGAGGGACAGAGTTAGGCAGG - Intronic
1169827083 20:9781197-9781219 TTTTAGGAACAGAATTGGGTAGG + Intronic
1170253746 20:14316803-14316825 TGTGTGGAACAGAATAGTGGTGG - Intronic
1171470172 20:25364052-25364074 TGTGGGATACAGTAGTGGGGAGG - Intronic
1173034291 20:39393904-39393926 TGAGATGTGCAGAATTGGGTGGG - Intergenic
1173436006 20:43032898-43032920 TGTGCGATACAGAATTGCAGAGG + Intronic
1173538193 20:43831770-43831792 AGTGAGGTCCAGAATAGGGAAGG - Intergenic
1174146825 20:48458236-48458258 TGTGAGGGAGAGAAAGGGGGTGG - Intergenic
1174751492 20:53115661-53115683 AGTGAGGTGCAGAGGTGGGGAGG + Intronic
1178713778 21:34944673-34944695 TGTGAATGGCAGAATTGGGGAGG + Intronic
1182609258 22:31532890-31532912 TGTGGGTTAGGGAATTGGGGTGG + Intronic
1182715880 22:32356028-32356050 TGTAAGGTGAAGAATTGAGGCGG + Intronic
1185101536 22:48843381-48843403 TGTGGGGTGCAGAATGTGGGGGG + Intronic
952960586 3:38586811-38586833 TGAGAGGTCCAGACATGGGGTGG - Intronic
953193141 3:40708396-40708418 GGTGAGGTATGGAGTTGGGGTGG + Intergenic
956798069 3:72733756-72733778 TGTGGCCTACAGAAATGGGGAGG - Intergenic
958923196 3:100129093-100129115 TGTGAGGTACGGGCTAGGGGTGG - Intronic
960327873 3:116319028-116319050 AGTGTTGTATAGAATTGGGGGGG + Intronic
960429677 3:117553734-117553756 TGTGGAGTACAGAATTAGTGAGG - Intergenic
960674066 3:120177924-120177946 TATGAGGTACAGGAATTGGGTGG - Intronic
963757068 3:149246091-149246113 TGGGAGATACAGAATTACGGTGG - Intergenic
964256213 3:154777288-154777310 TCTGACGTCCAGAATTTGGGGGG + Intergenic
964585679 3:158297633-158297655 TGTGAGTTATAGAATCTGGGTGG + Intronic
964696670 3:159515976-159515998 GGGGAGATAAAGAATTGGGGGGG + Intronic
966055830 3:175688408-175688430 TGGGAGAGACAGAATTGGGCTGG + Intronic
966895254 3:184440009-184440031 TGTGGGGCACAAAATGGGGGTGG - Intronic
967224282 3:187275970-187275992 TGAGAGGTACAGATGGGGGGCGG - Intronic
969187728 4:5490716-5490738 TGTGGGGTGGAGAGTTGGGGAGG - Intronic
970204377 4:13641347-13641369 AGTGAGTTACAGAATTGGTTTGG + Intergenic
972452479 4:39216435-39216457 TGTGAGCTTCAGAATTAGAGAGG + Intronic
978714465 4:111824942-111824964 TGGGAGGTAAATTATTGGGGTGG + Intergenic
980071010 4:128243004-128243026 TGGGAGGTGAAGAATTGGAGAGG + Intergenic
981752744 4:148108478-148108500 TGTGAGGAACAGAAATCTGGTGG - Intronic
983187146 4:164713109-164713131 TGGGAGGTACATTTTTGGGGAGG - Intergenic
983767501 4:171503484-171503506 TGTGAGGTAGAGAGGAGGGGAGG + Intergenic
984607768 4:181804926-181804948 AGTGAGGCAGGGAATTGGGGAGG - Intergenic
984844748 4:184099925-184099947 TATGAGGTTCATAATTGGTGAGG - Intronic
986028205 5:3870954-3870976 TGTGTGGAACAGGATGGGGGCGG + Intergenic
987883670 5:23783519-23783541 TGTGAGATACAGAATTTGTGGGG + Intergenic
988623199 5:32844535-32844557 TGTGAGGTATAGAATGAGGAGGG + Intergenic
989359414 5:40583781-40583803 TATGAGGTACAGAGTTGAGTAGG - Intergenic
989594388 5:43142656-43142678 TCTGAGAGACAGAATGGGGGTGG - Intronic
989604481 5:43230783-43230805 TGTGAGGTACAGAATTGGGGAGG - Intronic
990465987 5:56071869-56071891 TGTGTGGGAAAGAAATGGGGAGG + Intergenic
993966214 5:94364213-94364235 TGAGAGCTACAGAACTGGAGAGG + Intronic
996870826 5:128191348-128191370 TTTGAGGTAGAGAATTGTGGAGG + Intergenic
998267406 5:140676689-140676711 TGTGGGGCTCAGCATTGGGGTGG - Exonic
999793495 5:154965767-154965789 TTTGATATACAGAATGGGGGAGG + Intronic
1000392732 5:160742302-160742324 TGTGAGTAACAGCATTAGGGGGG - Intronic
1004741742 6:18468284-18468306 TGTGAGGTAGGGAAGTGAGGAGG + Exonic
1006174799 6:32115477-32115499 TGTGAGGTTCAGTTGTGGGGTGG - Exonic
1007191225 6:40020619-40020641 TGTAAGATACTGAATTAGGGAGG - Intergenic
1009765070 6:68063088-68063110 TGTGAGAGACAGAGTTTGGGAGG + Intergenic
1010849363 6:80752837-80752859 GGTAAGGGATAGAATTGGGGAGG - Intergenic
1011250805 6:85370307-85370329 TGTGTGCTACAGAAGTGAGGTGG - Intergenic
1017177696 6:151520155-151520177 TGTGAGGTCCTGAGTAGGGGAGG + Intronic
1017280633 6:152620516-152620538 TGTGTGGAACAGCATTGAGGAGG - Intronic
1017910698 6:158790302-158790324 GGTGAGACACAGAATTGAGGAGG + Intronic
1021760875 7:23902395-23902417 AGTGAGGGACAGAGTGGGGGAGG + Intergenic
1021838967 7:24706846-24706868 TGGGTGGTGCAGAATTGGCGGGG - Intronic
1024156894 7:46635171-46635193 TGTGACATAGAGAATTGTGGGGG + Intergenic
1026848860 7:73712471-73712493 TGCGAGATACTGATTTGGGGGGG - Intronic
1027976711 7:85166652-85166674 TGTTAGTGACAGAATTGGGATGG + Intronic
1028658188 7:93235126-93235148 TGTGAGGTAGATATTTGGGAAGG + Intronic
1029186707 7:98744285-98744307 TGTAAGCTACAGAAATAGGGTGG - Intergenic
1029704039 7:102266408-102266430 TGGGGAGTACAGACTTGGGGAGG + Intronic
1030938255 7:115613832-115613854 TGGGAGCTCTAGAATTGGGGTGG + Intergenic
1032503370 7:132416882-132416904 TGTGATGAACAGTATGGGGGTGG - Intronic
1037757400 8:21720013-21720035 TGGGAGTAACAGAATTGGGGAGG - Intronic
1047644267 8:126853127-126853149 TCTGAGGGATAGAATTGGAGAGG - Intergenic
1048687481 8:136919970-136919992 TCATAGGCACAGAATTGGGGAGG + Intergenic
1049303220 8:141882777-141882799 TTTGAGATACAGGGTTGGGGAGG - Intergenic
1050526675 9:6552492-6552514 TCTGAGGTACAGAATTGTTCCGG + Intronic
1051098077 9:13489474-13489496 TGGGAGTTACAGACTTTGGGGGG + Intergenic
1051234319 9:14982530-14982552 TGGGAGGTGCAGCCTTGGGGTGG - Intergenic
1052404600 9:28043724-28043746 TGTGAGGTGGAGGATTGGGTGGG - Intronic
1053211413 9:36231933-36231955 AGGGAGGAACAGATTTGGGGAGG - Intronic
1053341781 9:37342306-37342328 TGGGAGGAACATATTTGGGGTGG + Intronic
1060745650 9:126129184-126129206 TGTGGGGTAGAGAACTGGGCAGG - Intergenic
1061939655 9:133877106-133877128 TGTGGGAAACAGAAATGGGGTGG - Intronic
1186709963 X:12183349-12183371 TGTGAAGGACAGATTTGGGGTGG - Intronic
1187502949 X:19854778-19854800 TGTGATGTAAAGAGTTGGGAAGG - Intronic
1187583766 X:20637692-20637714 TTTGAGGTAAAGGATTCGGGTGG - Intergenic
1188404009 X:29784073-29784095 TGTGAGGTATATAATTCGAGAGG - Intronic
1188976477 X:36682115-36682137 TGTAAGGTCTAGATTTGGGGGGG - Intergenic
1190878168 X:54474511-54474533 AGCAAGGTACAGAGTTGGGGAGG - Intronic
1192016324 X:67335543-67335565 TCTGAGGTTCAGAATTGAAGAGG - Intergenic
1192262011 X:69511156-69511178 AGTGAGGTCCAGAGTTGAGGTGG - Intronic
1194882075 X:99266265-99266287 TGTGAGTTAATGAATTGGTGAGG - Intergenic
1195322942 X:103735455-103735477 TTTGGGGTAAAGAAATGGGGAGG - Intergenic
1195430136 X:104779853-104779875 TGGGAGGTACAAAGTGGGGGTGG + Intronic
1197100152 X:122643790-122643812 TGTGAGGAACAGGATTTAGGAGG - Intergenic
1197582359 X:128299177-128299199 TGAGTGGCACAGAATGGGGGGGG - Intergenic
1197705312 X:129630473-129630495 ATTGAGGTACAGAATGGGGAGGG + Intergenic
1198278246 X:135117691-135117713 TGTGAGGTGGAGAATAGGTGGGG - Intergenic
1198292716 X:135254825-135254847 TGTGAGGTGGAGAATAGGTGGGG + Intronic
1198670305 X:139073137-139073159 TGTGAGACACAGAAAAGGGGGGG - Intronic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic