ID: 989606865

View in Genome Browser
Species Human (GRCh38)
Location 5:43252739-43252761
Sequence TTTCTAATCAGCCTAAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989606865 Original CRISPR TTTCTAATCAGCCTAAAAGG GGG (reversed) Intronic
904250496 1:29220483-29220505 TTCCTAAACAGCCTAAAACGAGG - Intronic
905490207 1:38337607-38337629 TTTGTAATCAGCATAAAAACTGG + Intergenic
909039745 1:70635088-70635110 TTTCTAATCAGCCTGGAAAATGG + Intergenic
911813280 1:102311391-102311413 TTTATAGTCAGCCTTAAAGTTGG - Intergenic
912723784 1:112041679-112041701 TTTCTCATCAGCTTTGAAGGGGG - Intergenic
915224383 1:154401887-154401909 TTTCTCATCAGCCTGGGAGGAGG - Intergenic
916551219 1:165851477-165851499 ATTCTCATCAGGCTATAAGGAGG - Intronic
918821408 1:189260277-189260299 TTTCGTATTAGCCTAAAATGTGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921580999 1:216896397-216896419 TATCAAATCAGCCTATAAAGGGG - Intronic
921809693 1:219498480-219498502 TTTCAAATCTGCCCAAAATGAGG - Intergenic
1067856320 10:49796681-49796703 TTTCTTATCAGACTTAAAAGAGG + Intergenic
1071733990 10:88277615-88277637 TTTCTCATCAATCTAAAAGTTGG + Intronic
1072098607 10:92207310-92207332 TTTCTACTCAGCCTAGTATGTGG - Intronic
1075148966 10:119909030-119909052 TTTATATTCAGCCTATAATGGGG - Exonic
1076313760 10:129526479-129526501 TTTGTAAACAGCTTACAAGGAGG + Intronic
1080410456 11:32019286-32019308 TTTCTGTTCAGCCTAAATTGAGG + Intronic
1088344586 11:108808425-108808447 TGTCTAATCATCCTAAAAGTAGG - Intronic
1092003192 12:5047921-5047943 TTTACAATCTGCCTAAAAGCAGG + Intergenic
1092175663 12:6404264-6404286 TTTCTAATAAGTCTAATAAGTGG + Intergenic
1092506110 12:9101897-9101919 TTTCTTAAGAGCATAAAAGGAGG + Intronic
1093421454 12:18979092-18979114 TTCCTTATCTGCCTAAAAGCAGG + Intergenic
1093709114 12:22309326-22309348 TGTCTCATCAGGCAAAAAGGAGG - Intronic
1095033447 12:37323588-37323610 TTTCCAATCGGCCTAAAAAACGG - Intergenic
1095207062 12:39450462-39450484 TCTCTCAACAGCCTAGAAGGTGG + Intergenic
1097353943 12:58580091-58580113 TTTCTAATAGGGCTTAAAGGAGG + Intronic
1099532728 12:83805364-83805386 TTTCTAATCAACCCATAAAGTGG - Intergenic
1100701166 12:97149773-97149795 TTCCTATTCAGACTAACAGGTGG + Intergenic
1105588720 13:21770681-21770703 TTTCTAATCAGTCTATAAATAGG + Intergenic
1106717790 13:32408982-32409004 CTTCTAATCAGACTGAAATGAGG + Intronic
1108970932 13:56375635-56375657 TTTCTAATCAAACTAAAAGAGGG + Intergenic
1110372495 13:74755652-74755674 TTTCAAATGAGCCTTAAAGCTGG + Intergenic
1110453595 13:75664975-75664997 TTCCTAAGGAGCCTTAAAGGTGG + Intronic
1110455214 13:75683811-75683833 TTTTTAATCAACCTATAAGCTGG - Intronic
1112955214 13:105049516-105049538 TTTCTGACCACCCTAAAAAGTGG - Intergenic
1116274043 14:42807433-42807455 TTTCTAATCAACTTCTAAGGTGG + Intergenic
1116857597 14:49966626-49966648 TAACTAATCTGCCTAAAGGGTGG - Intergenic
1118286475 14:64478863-64478885 TTTTTAATCTGGCCAAAAGGTGG - Exonic
1119575610 14:75718840-75718862 TTTCTACTCAGACTAAAAATAGG + Intronic
1120079493 14:80199484-80199506 TTACTAATCTGCCTCTAAGGAGG + Intronic
1120908482 14:89642972-89642994 TTTCTCACCAGACTATAAGGAGG - Intergenic
1123888992 15:24756658-24756680 TTTCTACTCAGACTTAAAGTTGG + Intergenic
1130150852 15:81310523-81310545 TTTCTATTAAGTCTAAAAAGTGG - Exonic
1131456607 15:92586917-92586939 TTTCTAATCACACTGAACGGCGG + Intergenic
1133574745 16:7078090-7078112 TTTCTCATGAGCCAAAGAGGAGG - Intronic
1137475045 16:48800490-48800512 TTTATAACCATCCTAAAAGGTGG + Intergenic
1140863455 16:79039486-79039508 TTTCTAATCAGCCTTTACGATGG - Intronic
1140910375 16:79445848-79445870 TGTCTTATCAGGCTAAAAGCTGG - Intergenic
1141938768 16:87260327-87260349 TCTCTTATCAGGCAAAAAGGAGG - Intronic
1144791520 17:17862173-17862195 TTTCTGTTCAGCCTAAAGGCGGG - Intronic
1146254960 17:31386634-31386656 TTTAGAACCAGTCTAAAAGGGGG - Intergenic
1147455747 17:40537020-40537042 TCTCTAATCAGCCTCAGAGAGGG + Intergenic
1150880436 17:69019580-69019602 TGTCTAATCACCCTCAAGGGTGG + Intronic
1150973047 17:70052274-70052296 TTTCAAATCATACTAAAAGGTGG - Intergenic
1152882115 17:82823604-82823626 TTTCTAAACAGTCTTAACGGGGG - Intronic
1158384314 18:56971848-56971870 TTTCAAATCAGCATAATATGGGG + Intronic
1159601572 18:70433193-70433215 TCTCTTATCAGGCAAAAAGGAGG + Intergenic
1160114080 18:76060871-76060893 TTTTTCATCACCCTAAAAGGAGG + Intergenic
1160368165 18:78347298-78347320 TTCTTAATCAGCCTGAAATGTGG - Intergenic
1161518379 19:4709936-4709958 TGATTAATCAGCCTAGAAGGAGG - Intronic
1162018841 19:7859678-7859700 TCTCTAACGAGCCTGAAAGGCGG - Intronic
1164919921 19:32081744-32081766 TTTCTCACCAGCCCAAAATGTGG - Intergenic
926844134 2:17115344-17115366 TTGCTAATCAGTCTAATAAGAGG + Intergenic
927639476 2:24837742-24837764 TTTCTAATCAGACTGACAGGAGG + Intronic
929402489 2:41601431-41601453 TTTCAAAACAGCTGAAAAGGAGG - Intergenic
929745677 2:44655484-44655506 TATATAATCAGCCTAGAAGTGGG - Intronic
930222061 2:48755352-48755374 GTTCTCATCACCCTAAAACGTGG + Intronic
935686266 2:105686740-105686762 TTTCTAATCAGCCTTAACTCCGG + Intergenic
937276546 2:120688152-120688174 CTTCAAGTCAGCCTTAAAGGGGG - Intergenic
937386990 2:121443674-121443696 TTTCTAATAAGCCTCACTGGTGG - Intronic
938574217 2:132588897-132588919 TTTGGAATCAGCCTCAAATGGGG + Intronic
939519576 2:143212966-143212988 TTTCTACCCAGGCTAAAAGATGG + Intronic
941345359 2:164361833-164361855 GTCCTAATTACCCTAAAAGGTGG + Intergenic
946158623 2:217822670-217822692 GTTCAAAACAGCCTAAGAGGGGG + Intronic
946616998 2:221521007-221521029 TTTCTAAAAAGCGTCAAAGGGGG - Intronic
947919640 2:233857955-233857977 TTTCTTAGCAGCCTAATAGGTGG - Intergenic
947941602 2:234061033-234061055 TTTCTCAACAACCTATAAGGTGG - Intronic
947959102 2:234219713-234219735 ATTCCAATCAGCTTAAGAGGAGG - Intergenic
1168825361 20:809449-809471 TTTCTAATCAGGAAAAAATGTGG - Intergenic
1168917944 20:1506630-1506652 GTTCTTATCAGCCGAAATGGGGG + Intergenic
1172267399 20:33628340-33628362 TTTCTAATAGGTCTAAATGGAGG + Exonic
1173242947 20:41313894-41313916 TTTCTTAAAGGCCTAAAAGGAGG - Intronic
1175558627 20:59896670-59896692 TTTCATATCAGCCTAAAACATGG - Intronic
1175567613 20:59993160-59993182 TTCCTAATCAGCATTAAGGGAGG + Intronic
1175709164 20:61205561-61205583 TGTCTAACCAGAATAAAAGGAGG - Intergenic
1177892725 21:26826032-26826054 TTTCTAATCATCAAAAAATGTGG - Intergenic
1178986807 21:37311902-37311924 ATTCTAATCTGATTAAAAGGTGG - Intergenic
1182865874 22:33603990-33604012 TTTCTCATCAGTAGAAAAGGTGG - Intronic
1184115934 22:42422296-42422318 TTTCAAAACAGGCAAAAAGGAGG - Intronic
1184427009 22:44415940-44415962 TATCTAATTAACCTAAAAGTAGG - Intergenic
950002980 3:9671849-9671871 TTTTAAATGATCCTAAAAGGTGG + Intronic
950826419 3:15827415-15827437 ATACTATTCAGCCTTAAAGGAGG + Intronic
951062035 3:18220359-18220381 TTTATATTCTGCCTAAAAGTAGG - Intronic
953231917 3:41072989-41073011 CTCATAATAAGCCTAAAAGGGGG + Intergenic
957595843 3:82264353-82264375 ATTCTGATTAGCCTGAAAGGAGG - Intergenic
957986429 3:87577602-87577624 TGTTTAAGCAACCTAAAAGGAGG - Intergenic
960338735 3:116449039-116449061 TTTCTAAACAGCCTAAATTAGGG - Intronic
960437037 3:117639161-117639183 TATCTAATGAGCCTAAAAACAGG + Intergenic
961123374 3:124393425-124393447 TTTCAAATCAGCATAAAACCAGG - Intronic
962289879 3:134125655-134125677 TTTATAATCAGCAGAGAAGGAGG + Intronic
964531340 3:157671259-157671281 TTCCTTATCAACCTAGAAGGTGG - Intronic
966437292 3:179902949-179902971 TTTATAATCAGAACAAAAGGAGG - Intronic
967402960 3:189083866-189083888 TTTTTAATAACCCTAACAGGAGG - Intronic
969133200 4:5007358-5007380 ATACTATTCAGCCAAAAAGGGGG + Intergenic
971076383 4:23153817-23153839 TTTCTAATCAGACTTAGTGGTGG - Intergenic
976380818 4:84396318-84396340 TTTTTAAACAGACTAAAAGTTGG + Intergenic
977267159 4:94868493-94868515 TTTTTATTCAGCAAAAAAGGGGG + Intronic
984216996 4:176926081-176926103 TTTTTAATGAGATTAAAAGGTGG - Intergenic
984221411 4:176982180-176982202 TTTCTATTCGGCATAAAAGTTGG + Intergenic
984928820 4:184828428-184828450 TTTCTCCTCAGGCTATAAGGGGG + Intergenic
986689658 5:10303852-10303874 TTTGTTATCAGGCAAAAAGGAGG - Intronic
989043625 5:37253206-37253228 ATTCTAATCAACCTACAAAGTGG + Intergenic
989606865 5:43252739-43252761 TTTCTAATCAGCCTAAAAGGGGG - Intronic
993975120 5:94469883-94469905 TTTCTAATTAGCCAGAAAGCAGG + Intronic
998396758 5:141823710-141823732 TTTCTATTACCCCTAAAAGGAGG - Intergenic
999794269 5:154973910-154973932 TTTCTAATCCACTTAAAAAGTGG - Intergenic
1000884120 5:166731575-166731597 TTTCTTCTCAGTCTAAAATGAGG - Intergenic
1001644402 5:173269422-173269444 TTTCTGAGCTGCCTAAAATGAGG - Intergenic
1001899494 5:175413530-175413552 TTTCTAATCAGCCCAAACCTCGG + Intergenic
1010738836 6:79474878-79474900 TTTCTAATCAAACTCAAAGATGG + Intergenic
1013214080 6:108011569-108011591 TTTCTCATCATCTTGAAAGGTGG - Intergenic
1013659515 6:112280691-112280713 CTTCTAAGCAGCCTTCAAGGAGG + Intergenic
1014638754 6:123882375-123882397 TTTCAAACCACCCTAAAATGGGG + Intronic
1017078531 6:150643183-150643205 TTTTTAAACAGGCTAAAAGTTGG - Intronic
1021917154 7:25444975-25444997 TATCTAATTGGCCTAAAAGAAGG - Intergenic
1023733810 7:43217591-43217613 TTTCAAATGACCGTAAAAGGGGG + Intronic
1028644483 7:93079993-93080015 ATTCTAAACAACTTAAAAGGAGG + Intergenic
1031763713 7:125747463-125747485 TCTCTGATCTGCCTAAATGGAGG + Intergenic
1032948776 7:136883211-136883233 TTTCTAAGCTCCCTAGAAGGTGG - Intronic
1033464308 7:141577224-141577246 TTTCTTATCAGCCTTAAGGTTGG - Intronic
1039130527 8:34259059-34259081 TTTTTAATCTTCCTAAAAGTTGG + Intergenic
1039359907 8:36864772-36864794 TTTCTAAAGTGCCTGAAAGGTGG - Intronic
1039501022 8:38017502-38017524 TTTCAAATCAGGATAAATGGGGG - Intergenic
1040882179 8:52217867-52217889 TTCCTCTTCAGCCTAAAAGAAGG - Exonic
1041843846 8:62304416-62304438 TTACAAATCATACTAAAAGGGGG - Intronic
1042520030 8:69701620-69701642 TTTTTAATCTACCTAAAAGCTGG + Intronic
1042601664 8:70504822-70504844 TTTCTATTTGGCCTAAAATGTGG + Intergenic
1043258887 8:78172502-78172524 TTTCTAATAAGTCTACAAGTAGG + Intergenic
1044989835 8:97786058-97786080 TGACAAATCAGCCCAAAAGGTGG - Intronic
1045020461 8:98038954-98038976 TTCATAATCAGCCTAAAAGTTGG + Intronic
1048019431 8:130524922-130524944 ATTATAATCATCCTACAAGGGGG - Intergenic
1050936604 9:11404690-11404712 TTTCTACCTAGCCTCAAAGGAGG - Intergenic
1051479752 9:17546582-17546604 ATTCCAATCAACTTAAAAGGAGG + Intergenic
1055579797 9:77696853-77696875 TTTCGAAAAAGCATAAAAGGGGG - Intergenic
1055710931 9:79061427-79061449 TTTCTAATCATTCTAAAATCAGG + Intergenic
1056955634 9:91078865-91078887 TTTCTTATCAGACTTAAAGTCGG - Intergenic
1058830824 9:108814779-108814801 TTTGTAATGATCCTAAAAAGAGG + Intergenic
1189009774 X:37035382-37035404 TTTCTAATCAGCCCCCAAAGAGG - Intergenic
1190288576 X:48976523-48976545 TTTCTCCTCTGCCTAAATGGGGG + Intronic
1193024936 X:76836532-76836554 TTTCTAATAATACTAAAAGTAGG + Intergenic
1198316806 X:135476245-135476267 TTTCTATTTAGACTAAAAGTAGG + Intergenic
1201319194 Y:12678457-12678479 TTTCTCATCAGACTTAAAGACGG + Intergenic