ID: 989607685

View in Genome Browser
Species Human (GRCh38)
Location 5:43260763-43260785
Sequence CCGGGCCTGTCGTCGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12726
Summary {0: 1, 1: 22, 2: 647, 3: 4223, 4: 7833}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989607685_989607694 7 Left 989607685 5:43260763-43260785 CCCCCACCCGACGACAGGCCCGG 0: 1
1: 22
2: 647
3: 4223
4: 7833
Right 989607694 5:43260793-43260815 ATGTTCCCCACCCTGTGTCCAGG 0: 60
1: 122
2: 289
3: 166
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989607685 Original CRISPR CCGGGCCTGTCGTCGGGTGG GGG (reversed) Intronic
Too many off-targets to display for this crispr