ID: 989609015

View in Genome Browser
Species Human (GRCh38)
Location 5:43273662-43273684
Sequence CTGGAAAAGCAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1430
Summary {0: 1, 1: 0, 2: 13, 3: 64, 4: 637}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989609015_989609023 19 Left 989609015 5:43273662-43273684 CCCTCCTCATTCTGCTTTTCCAG 0: 1
1: 0
2: 13
3: 64
4: 637
Right 989609023 5:43273704-43273726 ACACACCTTATGTCTTGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 109
989609015_989609022 18 Left 989609015 5:43273662-43273684 CCCTCCTCATTCTGCTTTTCCAG 0: 1
1: 0
2: 13
3: 64
4: 637
Right 989609022 5:43273703-43273725 CACACACCTTATGTCTTGCCTGG 0: 1
1: 1
2: 0
3: 9
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989609015 Original CRISPR CTGGAAAAGCAGAATGAGGA GGG (reversed) Intronic
900225244 1:1529915-1529937 CTGGAAAAGCAAAACCAGGTTGG + Intronic
900225244 1:1529915-1529937 CTGGAAAAGCAAAACCAGGTTGG + Intronic
900728347 1:4233763-4233785 CTGGAAAAGCAAAATGAAATTGG - Intergenic
900728347 1:4233763-4233785 CTGGAAAAGCAAAATGAAATTGG - Intergenic
902074802 1:13775807-13775829 CTGGCAGAGCAGAATGAGAATGG - Intronic
902074802 1:13775807-13775829 CTGGCAGAGCAGAATGAGAATGG - Intronic
902391196 1:16107934-16107956 CTGGAAAAGAAAGATCAGGAGGG + Intergenic
902391196 1:16107934-16107956 CTGGAAAAGAAAGATCAGGAGGG + Intergenic
902409659 1:16205568-16205590 CTGGAAGGGCAGGATAAGGAAGG + Exonic
902409659 1:16205568-16205590 CTGGAAGGGCAGGATAAGGAAGG + Exonic
902470003 1:16642725-16642747 CTGGCCCAGCAGAGTGAGGAGGG + Intergenic
902470003 1:16642725-16642747 CTGGCCCAGCAGAGTGAGGAGGG + Intergenic
903020992 1:20394179-20394201 CTACAAAAGGAGAAAGAGGATGG + Intergenic
903020992 1:20394179-20394201 CTACAAAAGGAGAAAGAGGATGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903259735 1:22124941-22124963 CTGGAAAGGCAGACTGGGCAGGG - Intronic
903259735 1:22124941-22124963 CTGGAAAGGCAGACTGGGCAGGG - Intronic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904648599 1:31987363-31987385 CTGGTAGGGCAGAGTGAGGAGGG - Intergenic
904648599 1:31987363-31987385 CTGGTAGGGCAGAGTGAGGAGGG - Intergenic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
906395059 1:45455656-45455678 CTGGAAAAGGATAATGGAGATGG + Intronic
906395059 1:45455656-45455678 CTGGAAAAGGATAATGGAGATGG + Intronic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
907680599 1:56559814-56559836 CTGGAAAATGGGGATGAGGAAGG + Intronic
907680599 1:56559814-56559836 CTGGAAAATGGGGATGAGGAAGG + Intronic
908015954 1:59836300-59836322 CAGGAAAAGCAGACTTTGGAAGG + Intronic
908015954 1:59836300-59836322 CAGGAAAAGCAGACTTTGGAAGG + Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
908427207 1:64018645-64018667 CAGGAAAAGCAGTATGGAGAGGG + Intronic
908427207 1:64018645-64018667 CAGGAAAAGCAGTATGGAGAGGG + Intronic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
910238020 1:85055805-85055827 CGGAGAAAGGAGAATGAGGAAGG + Intronic
910238020 1:85055805-85055827 CGGAGAAAGGAGAATGAGGAAGG + Intronic
910535005 1:88287728-88287750 CTAGAAAAACAGAATTAGGCTGG - Intergenic
910535005 1:88287728-88287750 CTAGAAAAACAGAATTAGGCTGG - Intergenic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
913158931 1:116128220-116128242 CTGGAACAGCTGGATGAAGATGG + Exonic
913158931 1:116128220-116128242 CTGGAACAGCTGGATGAAGATGG + Exonic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913969284 1:143402258-143402280 CTGGACAAGCAGATTGTGAAGGG + Intergenic
913969284 1:143402258-143402280 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914063661 1:144227857-144227879 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914063661 1:144227857-144227879 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914115489 1:144738497-144738519 CTGGACAAGCAGATTGTGAAGGG - Intergenic
914115489 1:144738497-144738519 CTGGACAAGCAGATTGTGAAGGG - Intergenic
914398884 1:147297267-147297289 CTGGGAAAGTAGAATGAGACAGG + Intergenic
914398884 1:147297267-147297289 CTGGGAAAGTAGAATGAGACAGG + Intergenic
914920793 1:151846208-151846230 CTGGAAATACAGAAAGAGGTGGG - Intergenic
914920793 1:151846208-151846230 CTGGAAATACAGAAAGAGGTGGG - Intergenic
914978334 1:152388143-152388165 CTCTAAAAGTAGAATGAGGTTGG - Intergenic
914978334 1:152388143-152388165 CTCTAAAAGTAGAATGAGGTTGG - Intergenic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915723972 1:158004599-158004621 CTGGAAAAGCACTCTCAGGACGG + Intronic
915723972 1:158004599-158004621 CTGGAAAAGCACTCTCAGGACGG + Intronic
915881245 1:159674108-159674130 CTGGAAAAGGAAAATGTAGATGG + Intergenic
915881245 1:159674108-159674130 CTGGAAAAGGAAAATGTAGATGG + Intergenic
915959254 1:160251056-160251078 CTTGAGTAGCAGAATGAGGCAGG - Intronic
915959254 1:160251056-160251078 CTTGAGTAGCAGAATGAGGCAGG - Intronic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916392140 1:164342412-164342434 CTGGCAAAGCAGTGGGAGGAGGG - Intergenic
916392140 1:164342412-164342434 CTGGCAAAGCAGTGGGAGGAGGG - Intergenic
916870147 1:168904713-168904735 CTGGAACAGAAAAATGATGATGG + Intergenic
916870147 1:168904713-168904735 CTGGAACAGAAAAATGATGATGG + Intergenic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
918713873 1:187765283-187765305 CAGAAAAAGCAGAATGAAAAAGG - Intergenic
918713873 1:187765283-187765305 CAGAAAAAGCAGAATGAAAAAGG - Intergenic
919881960 1:201906726-201906748 CTGGAAAAGAAGTTTAAGGAGGG + Intronic
919881960 1:201906726-201906748 CTGGAAAAGAAGTTTAAGGAGGG + Intronic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
921819115 1:219596437-219596459 CTGGAAAAGAGGAGTGAGAAGGG + Intergenic
921819115 1:219596437-219596459 CTGGAAAAGAGGAGTGAGAAGGG + Intergenic
921879937 1:220244774-220244796 TTGGCAAAGCAGAATGACAATGG + Intronic
921879937 1:220244774-220244796 TTGGCAAAGCAGAATGACAATGG + Intronic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG + Intergenic
923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG + Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924735283 1:246750095-246750117 TTCGAACAGCAGAAAGAGGATGG - Intronic
924735283 1:246750095-246750117 TTCGAACAGCAGAAAGAGGATGG - Intronic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1065385117 10:25126383-25126405 TTGTAAAAGCAGATTGAGGCTGG - Intergenic
1065385117 10:25126383-25126405 TTGTAAAAGCAGATTGAGGCTGG - Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067420445 10:46140850-46140872 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067420445 10:46140850-46140872 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067425576 10:46208683-46208705 CTGGAAAGACAGAATGGGGCTGG - Intergenic
1067425576 10:46208683-46208705 CTGGAAAGACAGAATGGGGCTGG - Intergenic
1067505789 10:46847331-46847353 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067505789 10:46847331-46847353 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1068584562 10:58782700-58782722 CTGGAAAACCTGATTGAAGAGGG + Intronic
1068584562 10:58782700-58782722 CTGGAAAACCTGATTGAAGAGGG + Intronic
1068802669 10:61160041-61160063 CTGGCATAACAGAATGAGGGTGG - Intergenic
1068802669 10:61160041-61160063 CTGGCATAACAGAATGAGGGTGG - Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1070667129 10:78353186-78353208 CTGCAAAAGGAAAATGAGCAAGG - Intergenic
1070667129 10:78353186-78353208 CTGCAAAAGGAAAATGAGCAAGG - Intergenic
1071030277 10:81171736-81171758 CTGGAAAAGGTGAAAAAGGAAGG + Intergenic
1071030277 10:81171736-81171758 CTGGAAAAGGTGAAAAAGGAAGG + Intergenic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071213286 10:83369170-83369192 TTGGAAAAGCTGCATGAGTATGG - Intergenic
1071213286 10:83369170-83369192 TTGGAAAAGCTGCATGAGTATGG - Intergenic
1071477849 10:86040087-86040109 CTGAAAAAGCAGAGTTAAGATGG + Intronic
1071477849 10:86040087-86040109 CTGAAAAAGCAGAGTTAAGATGG + Intronic
1071934081 10:90507310-90507332 GTGGAAAAGAGGCATGAGGAAGG + Intergenic
1071934081 10:90507310-90507332 GTGGAAAAGAGGCATGAGGAAGG + Intergenic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1073075638 10:100824625-100824647 CTGGAAAAACACAAAGGGGAAGG - Intronic
1073075638 10:100824625-100824647 CTGGAAAAACACAAAGGGGAAGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073775308 10:106778776-106778798 CTAGAAAATCAGAGTGGGGAAGG - Intronic
1073775308 10:106778776-106778798 CTAGAAAATCAGAGTGGGGAAGG - Intronic
1074734058 10:116409635-116409657 CTGGAACAGAAGAAAGAGGCAGG - Intergenic
1074734058 10:116409635-116409657 CTGGAACAGAAGAAAGAGGCAGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075568276 10:123520375-123520397 CTGGGAAAGCATCATGGGGAGGG - Intergenic
1075568276 10:123520375-123520397 CTGGGAAAGCATCATGGGGAGGG - Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1076755839 10:132571169-132571191 CTGGGAATGCAGCATGAGGCAGG + Intronic
1076755839 10:132571169-132571191 CTGGGAATGCAGCATGAGGCAGG + Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076934383 10:133557797-133557819 CTGGTAGAGCAGAAAGAGGCAGG - Intronic
1076934383 10:133557797-133557819 CTGGTAGAGCAGAAAGAGGCAGG - Intronic
1077634373 11:3832032-3832054 CTGGAAAAGGATGATGAGTATGG + Intronic
1077634373 11:3832032-3832054 CTGGAAAAGGATGATGAGTATGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079522500 11:21344855-21344877 CTGGAGAAGCAGAATAATTAAGG - Intronic
1079522500 11:21344855-21344877 CTGGAGAAGCAGAATAATTAAGG - Intronic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080181262 11:29429198-29429220 GAGGTACAGCAGAATGAGGAAGG - Intergenic
1080181262 11:29429198-29429220 GAGGTACAGCAGAATGAGGAAGG - Intergenic
1080726829 11:34906390-34906412 CTGAAAGAGCAGACTGGGGAGGG + Intronic
1080726829 11:34906390-34906412 CTGAAAGAGCAGACTGGGGAGGG + Intronic
1081235509 11:40643024-40643046 CTTGAAAAGTAGAGTGAAGAAGG + Intronic
1081235509 11:40643024-40643046 CTTGAAAAGTAGAGTGAAGAAGG + Intronic
1082188790 11:49216746-49216768 CTGGCAAAGGAGACTGAGAAGGG - Intergenic
1082188790 11:49216746-49216768 CTGGCAAAGGAGACTGAGAAGGG - Intergenic
1082211074 11:49502124-49502146 TTGGAAAACCTGAATGAAGAAGG + Intergenic
1082211074 11:49502124-49502146 TTGGAAAACCTGAATGAAGAAGG + Intergenic
1083150615 11:60789663-60789685 CTGCAAAATGAGAGTGAGGACGG + Intronic
1083150615 11:60789663-60789685 CTGCAAAATGAGAGTGAGGACGG + Intronic
1083575637 11:63789092-63789114 CTAGAAAAGAAGAAAGAGGCTGG + Intergenic
1083575637 11:63789092-63789114 CTAGAAAAGAAGAAAGAGGCTGG + Intergenic
1083920168 11:65778180-65778202 CGGGAAAGGCAGAAAGAGGTCGG + Exonic
1083920168 11:65778180-65778202 CGGGAAAGGCAGAAAGAGGTCGG + Exonic
1084082725 11:66839406-66839428 CTGGAAGAGCCGAATTAGCAGGG + Intronic
1084082725 11:66839406-66839428 CTGGAAGAGCCGAATTAGCAGGG + Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1085468198 11:76738339-76738361 CTGAAAAAGCAGTGTCAGGAAGG + Intergenic
1085468198 11:76738339-76738361 CTGAAAAAGCAGTGTCAGGAAGG + Intergenic
1085742933 11:79092360-79092382 CTGGGAAAGGTGCATGAGGAGGG - Intronic
1085742933 11:79092360-79092382 CTGGGAAAGGTGCATGAGGAGGG - Intronic
1086638570 11:89122916-89122938 TTGGAAAACCTGAATGAAGAAGG - Intergenic
1086638570 11:89122916-89122938 TTGGAAAACCTGAATGAAGAAGG - Intergenic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1088115794 11:106311317-106311339 CCAGAAAAGCACAATGTGGAAGG + Intergenic
1088115794 11:106311317-106311339 CCAGAAAAGCACAATGTGGAAGG + Intergenic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1089407041 11:118206318-118206340 CTGGAAAAGGGGAAAGAGAAAGG - Intronic
1089407041 11:118206318-118206340 CTGGAAAAGGGGAAAGAGAAAGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090217664 11:124984216-124984238 CTGGAAAAGTGGCATGAGGGAGG + Intronic
1090217664 11:124984216-124984238 CTGGAAAAGTGGCATGAGGGAGG + Intronic
1090552934 11:127842514-127842536 CTGGACAAGCAGAGTTAGGGTGG - Intergenic
1090552934 11:127842514-127842536 CTGGACAAGCAGAGTTAGGGTGG - Intergenic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091838221 12:3600953-3600975 CTGGAAATGCAGCATGGTGAGGG - Intergenic
1091838221 12:3600953-3600975 CTGGAAATGCAGCATGGTGAGGG - Intergenic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1093020340 12:14197639-14197661 CTGGAATAGAAGAATAAGGAGGG + Intergenic
1093020340 12:14197639-14197661 CTGGAATAGAAGAATAAGGAGGG + Intergenic
1093426822 12:19037112-19037134 CTGGAAAACAGGAATTAGGAAGG + Intergenic
1093426822 12:19037112-19037134 CTGGAAAACAGGAATTAGGAAGG + Intergenic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096533758 12:52258075-52258097 CTAGAAATGGGGAATGAGGATGG - Intronic
1096533758 12:52258075-52258097 CTAGAAATGGGGAATGAGGATGG - Intronic
1097492160 12:60283438-60283460 CTGCCAAAGCTGAATGAGCAAGG - Intergenic
1097492160 12:60283438-60283460 CTGCCAAAGCTGAATGAGCAAGG - Intergenic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG + Intergenic
1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1099697907 12:86044578-86044600 CTGGCAAAGCAGCATGGGGGAGG + Intronic
1099697907 12:86044578-86044600 CTGGCAAAGCAGCATGGGGGAGG + Intronic
1100892093 12:99137009-99137031 CTTGGAAACGAGAATGAGGAAGG - Intronic
1100892093 12:99137009-99137031 CTTGGAAACGAGAATGAGGAAGG - Intronic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1103428580 12:120861349-120861371 CTAGAAAAACAGAAAAAGGAAGG + Intronic
1103428580 12:120861349-120861371 CTAGAAAAACAGAAAAAGGAAGG + Intronic
1103876646 12:124132680-124132702 CTGGGCCAGCAGAATGAGAATGG - Intronic
1103876646 12:124132680-124132702 CTGGGCCAGCAGAATGAGAATGG - Intronic
1104737072 12:131141822-131141844 GTGGAAAAGCAGCATGGGTAAGG - Intergenic
1104737072 12:131141822-131141844 GTGGAAAAGCAGCATGGGTAAGG - Intergenic
1104924502 12:132306833-132306855 CCGTAAAAGCAGAATGACCACGG - Intronic
1104924502 12:132306833-132306855 CCGTAAAAGCAGAATGACCACGG - Intronic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1106373840 13:29164249-29164271 CTGGAAAGGCAGAGCGAGAAGGG - Intronic
1106373840 13:29164249-29164271 CTGGAAAGGCAGAGCGAGAAGGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107082206 13:36387231-36387253 CTGGAAATGCATAGTGGGGATGG + Intergenic
1107082206 13:36387231-36387253 CTGGAAATGCATAGTGGGGATGG + Intergenic
1107416976 13:40209994-40210016 CTAGAAAAGGAAAATGAGGCCGG + Intergenic
1107416976 13:40209994-40210016 CTAGAAAAGGAAAATGAGGCCGG + Intergenic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1108344100 13:49527362-49527384 GTGGAAATGCAGAGTGTGGAGGG - Intronic
1108344100 13:49527362-49527384 GTGGAAATGCAGAGTGTGGAGGG - Intronic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111194209 13:84851239-84851261 CTGGAAAAGCAAAGAGAGGCAGG - Intergenic
1111194209 13:84851239-84851261 CTGGAAAAGCAAAGAGAGGCAGG - Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111350830 13:87028768-87028790 ATGGAATAGTAGAATGTGGATGG + Intergenic
1111350830 13:87028768-87028790 ATGGAATAGTAGAATGTGGATGG + Intergenic
1112170784 13:96969802-96969824 CTGAAAGGGCAGACTGAGGAGGG + Intergenic
1112170784 13:96969802-96969824 CTGAAAGGGCAGACTGAGGAGGG + Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113217204 13:108055929-108055951 CTGGAAAAACAGAAATACGAAGG + Intergenic
1113217204 13:108055929-108055951 CTGGAAAAACAGAAATACGAAGG + Intergenic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115279379 14:31644301-31644323 CAGGAAAAACAGTATGAAGATGG - Intronic
1115279379 14:31644301-31644323 CAGGAAAAACAGTATGAAGATGG - Intronic
1115361885 14:32512632-32512654 CTGGAAAAGGGCAATGAGGGTGG + Intronic
1115361885 14:32512632-32512654 CTGGAAAAGGGCAATGAGGGTGG + Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1116023208 14:39486011-39486033 CTGGAAAAGGGGCATGAGAATGG - Intergenic
1116023208 14:39486011-39486033 CTGGAAAAGGGGCATGAGAATGG - Intergenic
1116027240 14:39530056-39530078 TGGGAAAAGCAGTATGAAGAGGG - Intergenic
1116027240 14:39530056-39530078 TGGGAAAAGCAGTATGAAGAGGG - Intergenic
1116837383 14:49783409-49783431 CTGGAAAAACAAAGTGTGGAGGG + Exonic
1116837383 14:49783409-49783431 CTGGAAAAACAAAGTGTGGAGGG + Exonic
1117873051 14:60220813-60220835 CTACAAGAGCAGAGTGAGGAGGG - Intergenic
1117873051 14:60220813-60220835 CTACAAGAGCAGAGTGAGGAGGG - Intergenic
1118920903 14:70149268-70149290 TGGGAAAAGCAGAATCAGGCTGG + Intronic
1118920903 14:70149268-70149290 TGGGAAAAGCAGAATCAGGCTGG + Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119256284 14:73200741-73200763 CTGGAAAAGCAGTTTCAAGAAGG + Intronic
1119256284 14:73200741-73200763 CTGGAAAAGCAGTTTCAAGAAGG + Intronic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1119982459 14:79097380-79097402 CTTGGAAAGCAGAAAGAGAATGG - Intronic
1119982459 14:79097380-79097402 CTTGGAAAGCAGAAAGAGAATGG - Intronic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1121351566 14:93177477-93177499 CTCTAAAAGCAGAGTGAGGCTGG + Intergenic
1121351566 14:93177477-93177499 CTCTAAAAGCAGAGTGAGGCTGG + Intergenic
1122201305 14:100124237-100124259 CTGACAAAGCTGAGTGAGGAAGG - Intronic
1122201305 14:100124237-100124259 CTGACAAAGCTGAGTGAGGAAGG - Intronic
1122277845 14:100604330-100604352 CTGGGAGAGCAGATTGGGGAAGG + Intergenic
1122277845 14:100604330-100604352 CTGGGAGAGCAGATTGGGGAAGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125818981 15:42611595-42611617 CTGGACAAGGACAATGAGGGTGG - Intronic
1125818981 15:42611595-42611617 CTGGACAAGGACAATGAGGGTGG - Intronic
1125998455 15:44186737-44186759 CTGGAAAAGGAGAAAAAGAAGGG - Intronic
1125998455 15:44186737-44186759 CTGGAAAAGGAGAAAAAGAAGGG - Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126857023 15:52848469-52848491 CAGGAAAACCACTATGAGGAAGG - Intergenic
1126857023 15:52848469-52848491 CAGGAAAACCACTATGAGGAAGG - Intergenic
1127814864 15:62599006-62599028 CTGGAATAGCACATTGAGGATGG + Intronic
1127814864 15:62599006-62599028 CTGGAATAGCACATTGAGGATGG + Intronic
1128159961 15:65417150-65417172 CTGGGAAAGGAGAATGGTGATGG - Intronic
1128159961 15:65417150-65417172 CTGGGAAAGGAGAATGGTGATGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128780380 15:70355200-70355222 CTGAAAAAGCAGAAAGAGCTGGG - Intergenic
1128780380 15:70355200-70355222 CTGAAAAAGCAGAAAGAGCTGGG - Intergenic
1128855212 15:71005167-71005189 TTGGGAAAACAGAATGAAGAAGG - Intronic
1128855212 15:71005167-71005189 TTGGGAAAACAGAATGAAGAAGG - Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1129952946 15:79608016-79608038 CAGGAACAGCAGGCTGAGGATGG - Intergenic
1129952946 15:79608016-79608038 CAGGAACAGCAGGCTGAGGATGG - Intergenic
1130948861 15:88570018-88570040 CTGGAATATAAGGATGAGGAAGG + Intergenic
1130948861 15:88570018-88570040 CTGGAATATAAGGATGAGGAAGG + Intergenic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132068961 15:98758605-98758627 CTGGGACAGCAGGATGAGCAGGG + Intronic
1132068961 15:98758605-98758627 CTGGGACAGCAGGATGAGCAGGG + Intronic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1134827180 16:17294197-17294219 CTGACAAAGCAGAGTGGGGAAGG + Intronic
1134827180 16:17294197-17294219 CTGACAAAGCAGAGTGGGGAAGG + Intronic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135464354 16:22672422-22672444 CTGGAAAAGCAGGAAGAGTGGGG - Intergenic
1135464354 16:22672422-22672444 CTGGAAAAGCAGGAAGAGTGGGG - Intergenic
1135832073 16:25783758-25783780 CTGGAAAAGCATAGTGGTGATGG - Intronic
1135832073 16:25783758-25783780 CTGGAAAAGCATAGTGGTGATGG - Intronic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137402748 16:48166576-48166598 CGTAAAAAGCAGAATGAAGATGG + Intergenic
1137402748 16:48166576-48166598 CGTAAAAAGCAGAATGAAGATGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1139195438 16:64913138-64913160 CTTAAAAAGCAGAATAAGCAGGG - Intergenic
1139195438 16:64913138-64913160 CTTAAAAAGCAGAATAAGCAGGG - Intergenic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1140028686 16:71316076-71316098 CTGGAAAATGAGGATGAGAATGG + Intergenic
1140028686 16:71316076-71316098 CTGGAAAATGAGGATGAGAATGG + Intergenic
1140119389 16:72070489-72070511 TCCGAACAGCAGAATGAGGATGG + Intronic
1140119389 16:72070489-72070511 TCCGAACAGCAGAATGAGGATGG + Intronic
1141010447 16:80392049-80392071 CTAGAATGGCAGAATGATGAGGG + Intergenic
1141010447 16:80392049-80392071 CTAGAATGGCAGAATGATGAGGG + Intergenic
1141046201 16:80718161-80718183 CTGGTATAGCAGAAAGAGCACGG - Intronic
1141046201 16:80718161-80718183 CTGGTATAGCAGAAAGAGCACGG - Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141581569 16:85003076-85003098 CTAGAAAAGCAGAGTAACGAAGG + Intronic
1141581569 16:85003076-85003098 CTAGAAAAGCAGAGTAACGAAGG + Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143129920 17:4671776-4671798 TTGGAAGAGGAGACTGAGGATGG - Exonic
1143129920 17:4671776-4671798 TTGGAAGAGGAGACTGAGGATGG - Exonic
1143496003 17:7312958-7312980 CCGGAAAAGCAGGATTAGGTAGG - Intronic
1143496003 17:7312958-7312980 CCGGAAAAGCAGGATTAGGTAGG - Intronic
1143757060 17:9074912-9074934 TGGGAAACGCAGAGTGAGGACGG - Intronic
1143757060 17:9074912-9074934 TGGGAAACGCAGAGTGAGGACGG - Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1144755255 17:17676302-17676324 CTGGAATAGGAGAAAGTGGAGGG - Intergenic
1144755255 17:17676302-17676324 CTGGAATAGGAGAAAGTGGAGGG - Intergenic
1145303522 17:21656773-21656795 CTAGACAAGGACAATGAGGAGGG + Intergenic
1145303522 17:21656773-21656795 CTAGACAAGGACAATGAGGAGGG + Intergenic
1145346521 17:22045076-22045098 CTAGACAAGGACAATGAGGAGGG - Intergenic
1145346521 17:22045076-22045098 CTAGACAAGGACAATGAGGAGGG - Intergenic
1146972988 17:37087440-37087462 CTGGAAAGGAAGATTGAGAATGG + Intronic
1146972988 17:37087440-37087462 CTGGAAAGGAAGATTGAGAATGG + Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148011961 17:44489666-44489688 CTAGAAAAACAAAAAGAGGAAGG + Intronic
1148011961 17:44489666-44489688 CTAGAAAAACAAAAAGAGGAAGG + Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148641432 17:49190834-49190856 CTGGAAAAGCAAACTTCGGAAGG + Intergenic
1148641432 17:49190834-49190856 CTGGAAAAGCAAACTTCGGAAGG + Intergenic
1149684384 17:58527028-58527050 CCGGAAGGGAAGAATGAGGAAGG + Intronic
1149684384 17:58527028-58527050 CCGGAAGGGAAGAATGAGGAAGG + Intronic
1150259539 17:63777406-63777428 CTGGAAAGGGAGTTTGAGGAAGG + Intronic
1150259539 17:63777406-63777428 CTGGAAAGGGAGTTTGAGGAAGG + Intronic
1150533795 17:66014169-66014191 CTGGTAAAGCAGCATGGGGGAGG + Intronic
1150533795 17:66014169-66014191 CTGGTAAAGCAGCATGGGGGAGG + Intronic
1150661124 17:67080481-67080503 CAGGAAGAGCAGACTGAGCATGG - Intronic
1150661124 17:67080481-67080503 CAGGAAGAGCAGACTGAGCATGG - Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151122740 17:71810529-71810551 ATGGAAAACCAAAACGAGGAGGG + Intergenic
1151122740 17:71810529-71810551 ATGGAAAACCAAAACGAGGAGGG + Intergenic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG + Intronic
1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153384972 18:4482608-4482630 TGGGAAAAGCAGAATGATGCAGG + Intergenic
1153384972 18:4482608-4482630 TGGGAAAAGCAGAATGATGCAGG + Intergenic
1155394035 18:25367714-25367736 CTGGAACTGCAGAGTGAGAAGGG + Intergenic
1155394035 18:25367714-25367736 CTGGAACTGCAGAGTGAGAAGGG + Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1155777283 18:29780885-29780907 TTGGTAGAGCAGCATGAGGAAGG + Intergenic
1155777283 18:29780885-29780907 TTGGTAGAGCAGCATGAGGAAGG + Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157543338 18:48528838-48528860 CTGTAAAATGAGAATGATGATGG + Intergenic
1157543338 18:48528838-48528860 CTGTAAAATGAGAATGATGATGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158531256 18:58264029-58264051 GTGGAAAAGCATAATCAGTAAGG - Intronic
1158531256 18:58264029-58264051 GTGGAAAAGCATAATCAGTAAGG - Intronic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159522313 18:69542029-69542051 CTGAAAAGGCAGAATGGAGATGG + Intronic
1159522313 18:69542029-69542051 CTGAAAAGGCAGAATGGAGATGG + Intronic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1160119849 18:76120569-76120591 CTGGAACAGTAGAATGACAAAGG + Intergenic
1160119849 18:76120569-76120591 CTGGAACAGTAGAATGACAAAGG + Intergenic
1161769137 19:6222036-6222058 CTGGAACAGCGGAAGGAGGTGGG - Intronic
1161769137 19:6222036-6222058 CTGGAACAGCGGAAGGAGGTGGG - Intronic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1163630014 19:18413535-18413557 CTGGGAAATCAAAATGAGGTTGG - Intergenic
1163630014 19:18413535-18413557 CTGGGAAATCAAAATGAGGTTGG - Intergenic
1165290341 19:34878913-34878935 TTAGAAAAGCAGAATCAGGCAGG + Intergenic
1165290341 19:34878913-34878935 TTAGAAAAGCAGAATCAGGCAGG + Intergenic
1165724107 19:38100692-38100714 CTGCAAAAGCAAAATCTGGAGGG - Intronic
1165724107 19:38100692-38100714 CTGCAAAAGCAAAATCTGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168075846 19:53980621-53980643 CTGGAAAAGCCAAAGGGGGAGGG + Intronic
1168075846 19:53980621-53980643 CTGGAAAAGCCAAAGGGGGAGGG + Intronic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168482426 19:56732725-56732747 CTGGAAATACAGGATGAGGTTGG + Intergenic
1168482426 19:56732725-56732747 CTGGAAATACAGGATGAGGTTGG + Intergenic
925142364 2:1558982-1559004 CGGGAAGAGCAGGGTGAGGAGGG + Intergenic
925142364 2:1558982-1559004 CGGGAAGAGCAGGGTGAGGAGGG + Intergenic
925148133 2:1594654-1594676 CGCGAAGAGCAGAATGAGAAGGG - Intergenic
925148133 2:1594654-1594676 CGCGAAGAGCAGAATGAGAAGGG - Intergenic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925899555 2:8498868-8498890 CTGCAAAATGAGGATGAGGATGG + Intergenic
925899555 2:8498868-8498890 CTGCAAAATGAGGATGAGGATGG + Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927899957 2:26812065-26812087 CTGGAAGACCAGGATGAGGTTGG + Intergenic
927899957 2:26812065-26812087 CTGGAAGACCAGGATGAGGTTGG + Intergenic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
928635616 2:33242969-33242991 CTGGAAAAGAAGATTCAGGAAGG - Intronic
928635616 2:33242969-33242991 CTGGAAAAGAAGATTCAGGAAGG - Intronic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
929445852 2:42000647-42000669 CTGCTAAAGCAGAACCAGGAAGG + Intergenic
929445852 2:42000647-42000669 CTGCTAAAGCAGAACCAGGAAGG + Intergenic
930213547 2:48669107-48669129 CTGGAAATACAGAGTGGGGATGG - Intronic
930213547 2:48669107-48669129 CTGGAAATACAGAGTGGGGATGG - Intronic
930628723 2:53728209-53728231 CTGGCAATGCTGAATGTGGAAGG + Intronic
930628723 2:53728209-53728231 CTGGCAATGCTGAATGTGGAAGG + Intronic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
931049168 2:58390691-58390713 CAGGGAAAGCAGAGTTAGGAAGG - Intergenic
931049168 2:58390691-58390713 CAGGGAAAGCAGAGTTAGGAAGG - Intergenic
931255512 2:60568832-60568854 CTAGAAATGCATAATGAGGATGG - Intergenic
931255512 2:60568832-60568854 CTAGAAATGCATAATGAGGATGG - Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
931653758 2:64491394-64491416 TGGGAAAAGCAGAATTAGAAAGG + Intergenic
931653758 2:64491394-64491416 TGGGAAAAGCAGAATTAGAAAGG + Intergenic
931871341 2:66463734-66463756 CTGGAAATGCAAAATGAGAGTGG - Intronic
931871341 2:66463734-66463756 CTGGAAATGCAAAATGAGAGTGG - Intronic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
934173977 2:89563159-89563181 CTGGACAAGCAGATTGTGAAGGG + Intergenic
934173977 2:89563159-89563181 CTGGACAAGCAGATTGTGAAGGG + Intergenic
934284292 2:91637508-91637530 CTGGACAAGCAGATTGTGAAGGG + Intergenic
934284292 2:91637508-91637530 CTGGACAAGCAGATTGTGAAGGG + Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935192573 2:100790808-100790830 CTGGAAAAGGAGTATGATGATGG - Intergenic
935192573 2:100790808-100790830 CTGGAAAAGGAGTATGATGATGG - Intergenic
935260172 2:101348239-101348261 TTGTAAAAGCAGAATAAGGTAGG - Exonic
935260172 2:101348239-101348261 TTGTAAAAGCAGAATAAGGTAGG - Exonic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
935958686 2:108402708-108402730 TTCGAACAGCAGAAAGAGGATGG + Intergenic
935958686 2:108402708-108402730 TTCGAACAGCAGAAAGAGGATGG + Intergenic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937366328 2:121264509-121264531 CTGGGAGTGCAGAATCAGGAGGG + Intronic
937366328 2:121264509-121264531 CTGGGAGTGCAGAATCAGGAGGG + Intronic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
937530876 2:122825576-122825598 CTACAAAATTAGAATGAGGATGG - Intergenic
937530876 2:122825576-122825598 CTACAAAATTAGAATGAGGATGG - Intergenic
937877261 2:126835290-126835312 CTGGGAGAGCAAAATGAGGCAGG - Intergenic
937877261 2:126835290-126835312 CTGGGAGAGCAAAATGAGGCAGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938729378 2:134134468-134134490 CAGGAAAAGCAGAATAGGCAGGG - Intronic
938729378 2:134134468-134134490 CAGGAAAAGCAGAATAGGCAGGG - Intronic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
939577545 2:143914585-143914607 CTTGGAAAGCAGTATGAAGATGG + Intergenic
939577545 2:143914585-143914607 CTTGGAAAGCAGTATGAAGATGG + Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940346759 2:152636770-152636792 TTAGAAAAGGACAATGAGGACGG - Intronic
940346759 2:152636770-152636792 TTAGAAAAGGACAATGAGGACGG - Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940553609 2:155193738-155193760 CAGGAAGAGCAGATTGAGCAAGG - Intergenic
940553609 2:155193738-155193760 CAGGAAGAGCAGATTGAGCAAGG - Intergenic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
940914402 2:159238741-159238763 CTAGAAAAAAACAATGAGGAAGG - Intronic
940914402 2:159238741-159238763 CTAGAAAAAAACAATGAGGAAGG - Intronic
941216124 2:162711505-162711527 CTGAAAATGCAGGATGAAGATGG - Intronic
941216124 2:162711505-162711527 CTGAAAATGCAGGATGAAGATGG - Intronic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941845945 2:170133251-170133273 CAGCAAAAGCAGTATGAAGAGGG + Intergenic
941845945 2:170133251-170133273 CAGCAAAAGCAGTATGAAGAGGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942076131 2:172358742-172358764 CTGGAAAACTAATATGAGGAGGG + Intergenic
942076131 2:172358742-172358764 CTGGAAAACTAATATGAGGAGGG + Intergenic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
942455621 2:176136574-176136596 CTGGGAAAGCAGAATGCGGGGGG - Intergenic
942455621 2:176136574-176136596 CTGGGAAAGCAGAATGCGGGGGG - Intergenic
943062459 2:183052877-183052899 CTGGAAAAGAAGCATCTGGAGGG + Intergenic
943062459 2:183052877-183052899 CTGGAAAAGAAGCATCTGGAGGG + Intergenic
943236853 2:185332753-185332775 GTGGAAAAGTAGACTGAAGAAGG + Intergenic
943236853 2:185332753-185332775 GTGGAAAAGTAGACTGAAGAAGG + Intergenic
945350239 2:208769042-208769064 CTGGAAAGGCAGAATGATTTTGG - Intronic
945350239 2:208769042-208769064 CTGGAAAGGCAGAATGATTTTGG - Intronic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946147513 2:217742132-217742154 CTGGAAAAGGAGGATGGTGATGG - Intronic
946147513 2:217742132-217742154 CTGGAAAAGGAGGATGGTGATGG - Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948055404 2:235006608-235006630 CTGGCAAAGCAGAGCGAGGGGGG - Intronic
948055404 2:235006608-235006630 CTGGCAAAGCAGAGCGAGGGGGG - Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948286525 2:236790178-236790200 CTGGAAATCCAAAATGAAGATGG - Intergenic
948286525 2:236790178-236790200 CTGGAAATCCAAAATGAAGATGG - Intergenic
949024748 2:241761746-241761768 CTGGCTACGCAGAATCAGGATGG - Intronic
949024748 2:241761746-241761768 CTGGCTACGCAGAATCAGGATGG - Intronic
1169641332 20:7755905-7755927 CTGGGATAGCATAATAAGGAGGG - Intergenic
1169641332 20:7755905-7755927 CTGGGATAGCATAATAAGGAGGG - Intergenic
1169852307 20:10065470-10065492 CTGGAAAGGCAGAAAGAAAAGGG + Intergenic
1169852307 20:10065470-10065492 CTGGAAAGGCAGAAAGAAAAGGG + Intergenic
1170209367 20:13833177-13833199 CTGCAAATGCAGAATGAAAATGG - Intergenic
1170209367 20:13833177-13833199 CTGCAAATGCAGAATGAAAATGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1171521044 20:25774458-25774480 CTAGACAAGGACAATGAGGAGGG + Exonic
1171521044 20:25774458-25774480 CTAGACAAGGACAATGAGGAGGG + Exonic
1171555880 20:26082021-26082043 CTAGACAAGGACAATGAGGAGGG - Intergenic
1171555880 20:26082021-26082043 CTAGACAAGGACAATGAGGAGGG - Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172564000 20:35914010-35914032 CTGGAAGAACAGGATCAGGAAGG - Intronic
1172564000 20:35914010-35914032 CTGGAAGAACAGGATCAGGAAGG - Intronic
1172574456 20:35996967-35996989 CAGGAAATGGAGAATGAAGAAGG - Intronic
1172574456 20:35996967-35996989 CAGGAAATGGAGAATGAAGAAGG - Intronic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1173327151 20:42044383-42044405 TTGGAAAACCAGAATGAGCCTGG - Intergenic
1173327151 20:42044383-42044405 TTGGAAAACCAGAATGAGCCTGG - Intergenic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175674455 20:60934730-60934752 CTGCAAACGGAAAATGAGGATGG - Intergenic
1175674455 20:60934730-60934752 CTGCAAACGGAAAATGAGGATGG - Intergenic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176648331 21:9371455-9371477 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1176648331 21:9371455-9371477 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1176654893 21:9579576-9579598 CTAGACAAGGACAATGAGGAGGG + Intergenic
1176654893 21:9579576-9579598 CTAGACAAGGACAATGAGGAGGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177854933 21:26390160-26390182 CTGGAAGAGCATGATGAGGTGGG - Intergenic
1177854933 21:26390160-26390182 CTGGAAGAGCATGATGAGGTGGG - Intergenic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1179092839 21:38283888-38283910 CAGGCAAAGGAGACTGAGGAGGG - Intronic
1179092839 21:38283888-38283910 CAGGCAAAGGAGACTGAGGAGGG - Intronic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181504002 22:23338540-23338562 CTGGCAAAGCTGAAAGAGAAGGG - Intergenic
1181504002 22:23338540-23338562 CTGGCAAAGCTGAAAGAGAAGGG - Intergenic
1182146856 22:28001937-28001959 CTAGAAAATCACAGTGAGGACGG + Intronic
1182146856 22:28001937-28001959 CTAGAAAATCACAGTGAGGACGG + Intronic
1182166862 22:28183480-28183502 TCAGCAAAGCAGAATGAGGAGGG - Intronic
1182166862 22:28183480-28183502 TCAGCAAAGCAGAATGAGGAGGG - Intronic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182550752 22:31099664-31099686 CTGGAATAACAGAATGCTGAGGG + Intronic
1182550752 22:31099664-31099686 CTGGAATAACAGAATGCTGAGGG + Intronic
1183293074 22:37014724-37014746 CTGGAAAAGGAGACTGAGGCTGG + Intronic
1183293074 22:37014724-37014746 CTGGAAAAGGAGACTGAGGCTGG + Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
1185121418 22:48973879-48973901 CTGGAAGAGCAGTAGGAGGGAGG - Intergenic
1185121418 22:48973879-48973901 CTGGAAGAGCAGTAGGAGGGAGG - Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
949474899 3:4434180-4434202 CTGGAAATGCATAATGTTGATGG + Intronic
949474899 3:4434180-4434202 CTGGAAATGCATAATGTTGATGG + Intronic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG + Intergenic
949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950048861 3:9970662-9970684 CTGGCAAAGCAAAATGAAAATGG + Intronic
950048861 3:9970662-9970684 CTGGCAAAGCAAAATGAAAATGG + Intronic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951666132 3:25125932-25125954 CAGGAAAACCAGACTGAGGGTGG + Intergenic
951666132 3:25125932-25125954 CAGGAAAACCAGACTGAGGGTGG + Intergenic
952914424 3:38222477-38222499 CTGCAAGAGCAGAGTGGGGAGGG + Intronic
952914424 3:38222477-38222499 CTGCAAGAGCAGAGTGGGGAGGG + Intronic
953077967 3:39588188-39588210 CTGGAAAAGCACATACAGGATGG - Intergenic
953077967 3:39588188-39588210 CTGGAAAAGCACATACAGGATGG - Intergenic
953241791 3:41155967-41155989 CTGGAATAGCAAGGTGAGGAAGG + Intergenic
953241791 3:41155967-41155989 CTGGAATAGCAAGGTGAGGAAGG + Intergenic
953528931 3:43721081-43721103 CTAGAAAAGAACAATGTGGAAGG + Intronic
953528931 3:43721081-43721103 CTAGAAAAGAACAATGTGGAAGG + Intronic
953540342 3:43812571-43812593 CTGGAAAAGCCTGATTAGGATGG + Intergenic
953540342 3:43812571-43812593 CTGGAAAAGCCTGATTAGGATGG + Intergenic
954046995 3:47940535-47940557 CTATAAAAGTAGAATGGGGAAGG + Intronic
954046995 3:47940535-47940557 CTATAAAAGTAGAATGGGGAAGG + Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954299428 3:49691529-49691551 CTGGCCCAGCAGAGTGAGGAGGG - Intronic
954299428 3:49691529-49691551 CTGGCCCAGCAGAGTGAGGAGGG - Intronic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
954792596 3:53144234-53144256 CTGGGACAGCAGAATGGAGAAGG - Intergenic
954792596 3:53144234-53144256 CTGGGACAGCAGAATGGAGAAGG - Intergenic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955755413 3:62220528-62220550 CTGGAACAGAAGAATAAGGAAGG + Intronic
955755413 3:62220528-62220550 CTGGAACAGAAGAATAAGGAAGG + Intronic
955824900 3:62935342-62935364 CTGGACAAGCAGAATTCAGAGGG - Intergenic
955824900 3:62935342-62935364 CTGGACAAGCAGAATTCAGAGGG - Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956371775 3:68571020-68571042 CAGGTAAAGCAGCATGAGGGAGG - Intergenic
956371775 3:68571020-68571042 CAGGTAAAGCAGCATGAGGGAGG - Intergenic
956829663 3:73033615-73033637 CTGGAAATGAATAATGATGATGG - Intronic
956829663 3:73033615-73033637 CTGGAAATGAATAATGATGATGG - Intronic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
957157074 3:76557843-76557865 CTGAAAAGCAAGAATGAGGAAGG - Intronic
957157074 3:76557843-76557865 CTGAAAAGCAAGAATGAGGAAGG - Intronic
957969874 3:87368982-87369004 ATGGAAGATCAGAATCAGGAGGG - Intergenic
957969874 3:87368982-87369004 ATGGAAGATCAGAATCAGGAGGG - Intergenic
958636192 3:96750319-96750341 CTGCAAAGGCAGAGTGAGGGAGG - Intergenic
958636192 3:96750319-96750341 CTGCAAAGGCAGAGTGAGGGAGG - Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
959883744 3:111475164-111475186 CTGGGAAAGCAGGCTCAGGATGG - Intronic
959883744 3:111475164-111475186 CTGGGAAAGCAGGCTCAGGATGG - Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960258041 3:115532787-115532809 CTGGAACATGTGAATGAGGATGG - Intergenic
960258041 3:115532787-115532809 CTGGAACATGTGAATGAGGATGG - Intergenic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
961541164 3:127600368-127600390 CTGGAAATGCAGAGTAAGGCAGG - Intronic
961541164 3:127600368-127600390 CTGGAAATGCAGAGTAAGGCAGG - Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
963812638 3:149794050-149794072 CTGGAAAAGAAGAGTAATGAGGG + Intronic
963812638 3:149794050-149794072 CTGGAAAAGAAGAGTAATGAGGG + Intronic
964202746 3:154136454-154136476 CTGGAATTGCAGGATGAGAAAGG + Intronic
964202746 3:154136454-154136476 CTGGAATTGCAGGATGAGAAAGG + Intronic
964951226 3:162296036-162296058 CTGAAAGAGCAGCATGAGAAAGG + Intergenic
964951226 3:162296036-162296058 CTGAAAGAGCAGCATGAGAAAGG + Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965858773 3:173121462-173121484 TTGGAAAGGTAGAATGAGGTGGG - Intronic
965858773 3:173121462-173121484 TTGGAAAGGTAGAATGAGGTGGG - Intronic
965888840 3:173484607-173484629 CTCTAAAAGGAGAATGAAGATGG + Intronic
965888840 3:173484607-173484629 CTCTAAAAGGAGAATGAAGATGG + Intronic
966164236 3:176999074-176999096 CTGGCACAGCAGAGAGAGGAGGG + Intergenic
966164236 3:176999074-176999096 CTGGCACAGCAGAGAGAGGAGGG + Intergenic
966690961 3:182740942-182740964 CTGTAACAGTAGAATGAGCAAGG - Intergenic
966690961 3:182740942-182740964 CTGTAACAGTAGAATGAGCAAGG - Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967139027 3:186537809-186537831 CTTGAAGAGAAGAATGAAGAAGG - Intergenic
967139027 3:186537809-186537831 CTTGAAGAGAAGAATGAAGAAGG - Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968135261 3:196216121-196216143 CTGGAAAAGCCAGATGAGGCCGG - Intronic
968135261 3:196216121-196216143 CTGGAAAAGCCAGATGAGGCCGG - Intronic
968186560 3:196636768-196636790 CTCGAAAAGCATAGTGAGGGGGG + Intergenic
968186560 3:196636768-196636790 CTCGAAAAGCATAGTGAGGGGGG + Intergenic
1202738551 3_GL000221v1_random:33529-33551 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1202738551 3_GL000221v1_random:33529-33551 CTGGGAAATAAGAATGGGGAGGG + Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
969660867 4:8526663-8526685 CAGGAAAAGCTGAATGTGGGAGG + Intergenic
969660867 4:8526663-8526685 CAGGAAAAGCTGAATGTGGGAGG + Intergenic
969827823 4:9771975-9771997 CTGGACAAGCAGATTGTGAAGGG + Intronic
969827823 4:9771975-9771997 CTGGACAAGCAGATTGTGAAGGG + Intronic
969981138 4:11156395-11156417 CTCGGAAAGCAGTATGAGAAGGG + Intergenic
969981138 4:11156395-11156417 CTCGGAAAGCAGTATGAGAAGGG + Intergenic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
970413894 4:15837622-15837644 CTGGAAAAGCACAGAGAGAAAGG - Intronic
970413894 4:15837622-15837644 CTGGAAAAGCACAGAGAGAAAGG - Intronic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972969763 4:44558969-44558991 TTGGAAGATCAGAATGAGGTCGG + Intergenic
972969763 4:44558969-44558991 TTGGAAGATCAGAATGAGGTCGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973254837 4:48099625-48099647 CTGAAAAAGAATAATGAGGGAGG + Intronic
973254837 4:48099625-48099647 CTGAAAAAGAATAATGAGGGAGG + Intronic
973370247 4:49240206-49240228 CTGGAAAATAAGAACGGGGAGGG - Intergenic
973370247 4:49240206-49240228 CTGGAAAATAAGAACGGGGAGGG - Intergenic
973390782 4:49555214-49555236 CTGGAAAATAAGAACGGGGAGGG + Intergenic
973390782 4:49555214-49555236 CTGGAAAATAAGAACGGGGAGGG + Intergenic
973573706 4:52265234-52265256 CTGGAACAGCAGGATGTGAAGGG + Intergenic
973573706 4:52265234-52265256 CTGGAACAGCAGGATGTGAAGGG + Intergenic
974099709 4:57403266-57403288 CTGGAAGAGCTGAATCAGGCAGG - Intergenic
974099709 4:57403266-57403288 CTGGAAGAGCTGAATCAGGCAGG - Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976340125 4:83937798-83937820 CTGGAAAAGAAGAATGGAAAAGG + Intergenic
976340125 4:83937798-83937820 CTGGAAAAGAAGAATGGAAAAGG + Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
978174598 4:105714440-105714462 CTAGAAAAGAAAAAAGAGGAAGG + Intronic
978174598 4:105714440-105714462 CTAGAAAAGAAAAAAGAGGAAGG + Intronic
978752812 4:112271497-112271519 CAGCAAAAGCAGTATCAGGATGG - Intergenic
978752812 4:112271497-112271519 CAGCAAAAGCAGTATCAGGATGG - Intergenic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982504767 4:156203453-156203475 TTGGAAATGCAGAATGATGTGGG - Intergenic
982504767 4:156203453-156203475 TTGGAAATGCAGAATGATGTGGG - Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983843279 4:172482748-172482770 GTGGAAAAGATGAATGATGAAGG - Intronic
983843279 4:172482748-172482770 GTGGAAAAGATGAATGATGAAGG - Intronic
983951104 4:173642593-173642615 CTGCAAAAGCAGCATGTGGTAGG - Intergenic
983951104 4:173642593-173642615 CTGCAAAAGCAGCATGTGGTAGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
1202767360 4_GL000008v2_random:159722-159744 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1202767360 4_GL000008v2_random:159722-159744 CTGGGAAATAAGAATGGGGAGGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
986109811 5:4702620-4702642 CTGGAAAAGATGAATGTAGATGG - Intergenic
986109811 5:4702620-4702642 CTGGAAAAGATGAATGTAGATGG - Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986818215 5:11436006-11436028 CTGGAATAGGAGAAAGACGACGG + Intronic
986818215 5:11436006-11436028 CTGGAATAGGAGAAAGACGACGG + Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987046642 5:14115238-14115260 TTACAAAAGCAGAATCAGGAAGG - Intergenic
987046642 5:14115238-14115260 TTACAAAAGCAGAATCAGGAAGG - Intergenic
987270592 5:16304484-16304506 CAGGAATACCAGAATGAGCAAGG + Intergenic
987270592 5:16304484-16304506 CAGGAATACCAGAATGAGCAAGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
991513856 5:67412070-67412092 CTTGAAACTCAGAATGAAGATGG + Intergenic
991513856 5:67412070-67412092 CTTGAAACTCAGAATGAAGATGG + Intergenic
991725824 5:69535014-69535036 TTGGAAGACCAGGATGAGGAGGG + Intronic
991725824 5:69535014-69535036 TTGGAAGACCAGGATGAGGAGGG + Intronic
991869130 5:71092841-71092863 TTGGAAGACCAGGATGAGGAGGG - Intergenic
991869130 5:71092841-71092863 TTGGAAGACCAGGATGAGGAGGG - Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992802459 5:80305935-80305957 TTGGAAAAGGAGAATGAAGTAGG - Intergenic
992802459 5:80305935-80305957 TTGGAAAAGGAGAATGAAGTAGG - Intergenic
993384658 5:87250775-87250797 AGGGAAAAGCAAATTGAGGAAGG - Intergenic
993384658 5:87250775-87250797 AGGGAAAAGCAAATTGAGGAAGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994613730 5:102077955-102077977 CTGGCAAAGCAGCATAAGGGAGG - Intergenic
994613730 5:102077955-102077977 CTGGCAAAGCAGCATAAGGGAGG - Intergenic
995122017 5:108546301-108546323 GAGGAAAAGCAGGATGAGAACGG - Intergenic
995122017 5:108546301-108546323 GAGGAAAAGCAGGATGAGAACGG - Intergenic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996794538 5:127330489-127330511 CTGGCAAAGGAGATTGAAGAGGG - Intronic
996794538 5:127330489-127330511 CTGGCAAAGGAGATTGAAGAGGG - Intronic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
998954604 5:147426317-147426339 CTGAAAAAGCTCAATGTGGAAGG + Intronic
998954604 5:147426317-147426339 CTGAAAAAGCTCAATGTGGAAGG + Intronic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999965347 5:156803528-156803550 TTGGGAAACCAGAATGGGGAGGG + Intergenic
999965347 5:156803528-156803550 TTGGGAAACCAGAATGGGGAGGG + Intergenic
1000268949 5:159664726-159664748 GTGGAAAAGGAGCATGAGGGAGG - Intergenic
1000268949 5:159664726-159664748 GTGGAAAAGGAGCATGAGGGAGG - Intergenic
1002698330 5:181104875-181104897 GCGGAAAAGCAGCATCAGGATGG + Intergenic
1002698330 5:181104875-181104897 GCGGAAAAGCAGCATCAGGATGG + Intergenic
1002708567 5:181180033-181180055 GCGGAAAAGCAGCATCAGGATGG - Intergenic
1002708567 5:181180033-181180055 GCGGAAAAGCAGCATCAGGATGG - Intergenic
1002790315 6:432705-432727 CTGGAAAAGCACAATGGAAATGG - Intergenic
1002790315 6:432705-432727 CTGGAAAAGCACAATGGAAATGG - Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1004750265 6:18555239-18555261 ATGGAAAGGCAGAATGACAAAGG + Intergenic
1004750265 6:18555239-18555261 ATGGAAAGGCAGAATGACAAAGG + Intergenic
1004884620 6:20039652-20039674 CTATAAAAACAGAATGAGGCCGG + Intergenic
1004884620 6:20039652-20039674 CTATAAAAACAGAATGAGGCCGG + Intergenic
1005213165 6:23493125-23493147 TTGGAAGAGTAGAATGATGAAGG - Intergenic
1005213165 6:23493125-23493147 TTGGAAGAGTAGAATGATGAAGG - Intergenic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007634808 6:43292961-43292983 GTGGAAGAGAAGAGTGAGGAGGG + Intergenic
1007634808 6:43292961-43292983 GTGGAAGAGAAGAGTGAGGAGGG + Intergenic
1007643130 6:43358929-43358951 CTAGAAAAGCAGAACCAGCAGGG + Intronic
1007643130 6:43358929-43358951 CTAGAAAAGCAGAACCAGCAGGG + Intronic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009566551 6:65318248-65318270 CTGGAAAAGAGGAGTGAGAAGGG - Intronic
1009566551 6:65318248-65318270 CTGGAAAAGAGGAGTGAGAAGGG - Intronic
1010396063 6:75393477-75393499 CAGAAAAAGCATAATGAGAAAGG + Intronic
1010396063 6:75393477-75393499 CAGAAAAAGCATAATGAGAAAGG + Intronic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011839064 6:91473692-91473714 CTGGAAAAGCTGCAACAGGATGG - Intergenic
1011839064 6:91473692-91473714 CTGGAAAAGCTGCAACAGGATGG - Intergenic
1012382636 6:98638662-98638684 CAGGAAAAGAAGAACCAGGAGGG - Intergenic
1012382636 6:98638662-98638684 CAGGAAAAGAAGAACCAGGAGGG - Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015270256 6:131330745-131330767 CTGGAATAGCATAATGAGGGTGG - Intergenic
1015270256 6:131330745-131330767 CTGGAATAGCATAATGAGGGTGG - Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016514757 6:144881568-144881590 TTGGAAAAATAGAATTAGGAAGG + Intergenic
1016514757 6:144881568-144881590 TTGGAAAAATAGAATTAGGAAGG + Intergenic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017042189 6:150316476-150316498 CTGGAAGAGAAAAGTGAGGAGGG + Intergenic
1017042189 6:150316476-150316498 CTGGAAGAGAAAAGTGAGGAGGG + Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018006937 6:159631108-159631130 CAGGAAAAACACAATGGGGAAGG + Intergenic
1018006937 6:159631108-159631130 CAGGAAAAACACAATGGGGAAGG + Intergenic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1020940833 7:14535025-14535047 CAGCAAAAGCAGTATGAAGAGGG + Intronic
1020940833 7:14535025-14535047 CAGCAAAAGCAGTATGAAGAGGG + Intronic
1021281898 7:18730224-18730246 GTGGAATAGCAGAGTGAAGATGG - Intronic
1021281898 7:18730224-18730246 GTGGAATAGCAGAGTGAAGATGG - Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023595221 7:41822608-41822630 TTGGAAAAACAGAATGAAAAGGG - Intergenic
1023595221 7:41822608-41822630 TTGGAAAAACAGAATGAAAAGGG - Intergenic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1025281518 7:57629406-57629428 CTAGACAAGGACAATGAGGAGGG + Intergenic
1025281518 7:57629406-57629428 CTAGACAAGGACAATGAGGAGGG + Intergenic
1025303212 7:57836109-57836131 CTAGACAAGGACAATGAGGAGGG - Intergenic
1025303212 7:57836109-57836131 CTAGACAAGGACAATGAGGAGGG - Intergenic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027199618 7:76055234-76055256 TTTGAAAAGTAGTATGAGGATGG + Intronic
1027199618 7:76055234-76055256 TTTGAAAAGTAGTATGAGGATGG + Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028288837 7:89040773-89040795 CTGGAAAGGCTGACTGATGAAGG - Intronic
1028288837 7:89040773-89040795 CTGGAAAGGCTGACTGATGAAGG - Intronic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030521188 7:110600060-110600082 CTGCAAAAGTAAAATGTGGAAGG + Intergenic
1030521188 7:110600060-110600082 CTGCAAAAGTAAAATGTGGAAGG + Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030585969 7:111419988-111420010 CTGGAAATGGATAGTGAGGATGG + Intronic
1030585969 7:111419988-111420010 CTGGAAATGGATAGTGAGGATGG + Intronic
1030745537 7:113161094-113161116 CTGGAATGGTAGAATGAGGATGG - Intergenic
1030745537 7:113161094-113161116 CTGGAATGGTAGAATGAGGATGG - Intergenic
1031096801 7:117429724-117429746 CTGAAAAAGAAGAATAAAGAAGG + Intergenic
1031096801 7:117429724-117429746 CTGAAAAAGAAGAATAAAGAAGG + Intergenic
1031599197 7:123684938-123684960 CAGGAAAAGAAGATTGGGGAAGG - Intronic
1031599197 7:123684938-123684960 CAGGAAAAGAAGATTGGGGAAGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1032635215 7:133699470-133699492 CTGTAAAGGCAAAATGAGGGAGG + Intronic
1032635215 7:133699470-133699492 CTGTAAAGGCAAAATGAGGGAGG + Intronic
1033430983 7:141289417-141289439 CTTGAAAAGGAGAATGCGGCTGG + Intronic
1033430983 7:141289417-141289439 CTTGAAAAGGAGAATGCGGCTGG + Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034350446 7:150411669-150411691 CTGGAATAGCAGAATGCTCAGGG + Intronic
1034350446 7:150411669-150411691 CTGGAATAGCAGAATGCTCAGGG + Intronic
1034437715 7:151071049-151071071 CTGCCAAAGCAGCATGGGGATGG - Intronic
1034437715 7:151071049-151071071 CTGCCAAAGCAGCATGGGGATGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1037287667 8:17318481-17318503 CTGGAACTGCAGCAGGAGGATGG + Intronic
1037287667 8:17318481-17318503 CTGGAACTGCAGCAGGAGGATGG + Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1038341161 8:26686203-26686225 CTACAAAAGCACCATGAGGAAGG - Intergenic
1038341161 8:26686203-26686225 CTACAAAAGCACCATGAGGAAGG - Intergenic
1038401779 8:27289281-27289303 CTGGAAAAGTACAATGGGTATGG + Intronic
1038401779 8:27289281-27289303 CTGGAAAAGTACAATGGGTATGG + Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038911169 8:31966347-31966369 CTGGAAAAGCAATAAGAGTAGGG + Intronic
1038911169 8:31966347-31966369 CTGGAAAAGCAATAAGAGTAGGG + Intronic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039279977 8:35973878-35973900 CTGGAAAAGAACAATAAGGTAGG + Intergenic
1039279977 8:35973878-35973900 CTGGAAAAGAACAATAAGGTAGG + Intergenic
1041507006 8:58610303-58610325 CAGTTAAAGCAGAATGAGAAGGG - Intronic
1041507006 8:58610303-58610325 CAGTTAAAGCAGAATGAGAAGGG - Intronic
1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG + Intergenic
1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG + Intergenic
1042413293 8:68490044-68490066 CTAGAAAAGCAGAACAAGGCCGG - Intronic
1042413293 8:68490044-68490066 CTAGAAAAGCAGAACAAGGCCGG - Intronic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1042855704 8:73264901-73264923 CTATAAAACCAGAATGAGGTTGG + Intergenic
1042855704 8:73264901-73264923 CTATAAAACCAGAATGAGGTTGG + Intergenic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043333574 8:79146644-79146666 TTGAAAGCGCAGAATGAGGATGG - Intergenic
1043333574 8:79146644-79146666 TTGAAAGCGCAGAATGAGGATGG - Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044425714 8:92047397-92047419 ATGGAAAATCAGGATAAGGAGGG - Intronic
1044425714 8:92047397-92047419 ATGGAAAATCAGGATAAGGAGGG - Intronic
1046101277 8:109616832-109616854 CTGGGAATGCAAAAAGAGGATGG + Intronic
1046101277 8:109616832-109616854 CTGGGAATGCAAAAAGAGGATGG + Intronic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046731262 8:117728785-117728807 CAGGAAAAGGAGAACAAGGATGG - Intergenic
1046731262 8:117728785-117728807 CAGGAAAAGGAGAACAAGGATGG - Intergenic
1047216689 8:122881767-122881789 TTGGAAAAGCAGAAAGGGTATGG - Intronic
1047216689 8:122881767-122881789 TTGGAAAAGCAGAAAGGGTATGG - Intronic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048553428 8:135454804-135454826 CTGGGAAGGCAGAACCAGGAAGG + Intergenic
1048553428 8:135454804-135454826 CTGGGAAGGCAGAACCAGGAAGG + Intergenic
1048764882 8:137833076-137833098 CTAGAATAGCAGAGTCAGGAAGG + Intergenic
1048764882 8:137833076-137833098 CTAGAATAGCAGAGTCAGGAAGG + Intergenic
1049018109 8:139935919-139935941 CTGGAAATGCAGTGTCAGGATGG + Intronic
1049018109 8:139935919-139935941 CTGGAAATGCAGTGTCAGGATGG + Intronic
1049497166 8:142941466-142941488 CTGGAAACGCAGACTCAGGCTGG - Intergenic
1049497166 8:142941466-142941488 CTGGAAACGCAGACTCAGGCTGG - Intergenic
1049506612 8:143004354-143004376 CTGGAAAACCAGCATGAGATAGG - Intergenic
1049506612 8:143004354-143004376 CTGGAAAACCAGCATGAGATAGG - Intergenic
1049747154 8:144267807-144267829 CCGGAAAAGCAGGGTGAGCAGGG + Intronic
1049747154 8:144267807-144267829 CCGGAAAAGCAGGGTGAGCAGGG + Intronic
1050119756 9:2296101-2296123 CTTGAAAAGCAGGAAGAAGACGG + Intergenic
1050119756 9:2296101-2296123 CTTGAAAAGCAGGAAGAAGACGG + Intergenic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1052471442 9:28900657-28900679 CTGGACAAGCTGAATGATAAAGG + Intergenic
1052471442 9:28900657-28900679 CTGGACAAGCTGAATGATAAAGG + Intergenic
1053443640 9:38135596-38135618 CTGGAAAAGCAGGGTGAGGGGGG - Intergenic
1053443640 9:38135596-38135618 CTGGAAAAGCAGGGTGAGGGGGG - Intergenic
1053499563 9:38574061-38574083 CTGGGAAATAAGAATGGGGAGGG - Intronic
1053499563 9:38574061-38574083 CTGGGAAATAAGAATGGGGAGGG - Intronic
1053576294 9:39359268-39359290 CTGGGAAAGAAGATTGAAGATGG - Exonic
1053576294 9:39359268-39359290 CTGGGAAAGAAGATTGAAGATGG - Exonic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1053840805 9:42187193-42187215 CTGGGAAAGAAGACTGAAGATGG - Exonic
1053840805 9:42187193-42187215 CTGGGAAAGAAGACTGAAGATGG - Exonic
1054097863 9:60917959-60917981 CTGGGAAAGAAGATTGAAGATGG - Intergenic
1054097863 9:60917959-60917981 CTGGGAAAGAAGATTGAAGATGG - Intergenic
1054119265 9:61193589-61193611 CTGGGAAAGAAGATTGAAGATGG - Exonic
1054119265 9:61193589-61193611 CTGGGAAAGAAGATTGAAGATGG - Exonic
1054588488 9:66988973-66988995 CTGGGAAAGAAGATTGAAGATGG + Intergenic
1054588488 9:66988973-66988995 CTGGGAAAGAAGATTGAAGATGG + Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1054840335 9:69731621-69731643 CTACTAAAGCAGAATGAGGGTGG - Intronic
1054840335 9:69731621-69731643 CTACTAAAGCAGAATGAGGGTGG - Intronic
1055191749 9:73532914-73532936 TGGGAAGAGCAGGATGAGGAAGG - Intergenic
1055191749 9:73532914-73532936 TGGGAAGAGCAGGATGAGGAAGG - Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055729308 9:79264316-79264338 CTGGAAAAGGAGAGAGAGAAAGG - Intergenic
1055729308 9:79264316-79264338 CTGGAAAAGGAGAGAGAGAAAGG - Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1056688032 9:88782848-88782870 CTGGAAATGAAGAATGGGGAAGG + Intergenic
1056688032 9:88782848-88782870 CTGGAAATGAAGAATGGGGAAGG + Intergenic
1057317581 9:93979619-93979641 CTGGGACAGCAGAGTGAGTATGG - Intergenic
1057317581 9:93979619-93979641 CTGGGACAGCAGAGTGAGTATGG - Intergenic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057886626 9:98834576-98834598 CTGAAAAAGCAGCCTGAGGCTGG + Intronic
1057886626 9:98834576-98834598 CTGAAAAAGCAGCCTGAGGCTGG + Intronic
1058296223 9:103311412-103311434 CTGGAAAACTGGAATGAGAATGG - Intergenic
1058296223 9:103311412-103311434 CTGGAAAACTGGAATGAGAATGG - Intergenic
1059409783 9:114124713-114124735 CTAGAAAAGAAGACTGAGGCTGG + Intergenic
1059409783 9:114124713-114124735 CTAGAAAAGAAGACTGAGGCTGG + Intergenic
1060445280 9:123681444-123681466 CTGTAAAAACAGGGTGAGGAGGG + Intronic
1060445280 9:123681444-123681466 CTGTAAAAACAGGGTGAGGAGGG + Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1062324204 9:136004598-136004620 CTGTAACAGCAGAATCAGGCCGG + Intergenic
1062324204 9:136004598-136004620 CTGTAACAGCAGAATCAGGCCGG + Intergenic
1203707283 Un_KI270742v1:63976-63998 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1203707283 Un_KI270742v1:63976-63998 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1203632618 Un_KI270750v1:83029-83051 CTAGACAAGGACAATGAGGAGGG + Intergenic
1203632618 Un_KI270750v1:83029-83051 CTAGACAAGGACAATGAGGAGGG + Intergenic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187000600 X:15172907-15172929 CTGGAAAATGAGGATGAGAATGG - Intergenic
1187000600 X:15172907-15172929 CTGGAAAATGAGGATGAGAATGG - Intergenic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187128626 X:16479274-16479296 TTGGAAAAGCAGATTGCTGAAGG + Intergenic
1187128626 X:16479274-16479296 TTGGAAAAGCAGATTGCTGAAGG + Intergenic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188473905 X:30569630-30569652 CTGGAACAGTACAAGGAGGAAGG + Intronic
1188473905 X:30569630-30569652 CTGGAACAGTACAAGGAGGAAGG + Intronic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190187457 X:48248259-48248281 TTGGAAAAGAAGAATAAGGTGGG - Intronic
1190187457 X:48248259-48248281 TTGGAAAAGAAGAATAAGGTGGG - Intronic
1190191950 X:48284424-48284446 TTGGAAAAGAAGAATAAGGTGGG - Intergenic
1190191950 X:48284424-48284446 TTGGAAAAGAAGAATAAGGTGGG - Intergenic
1191177186 X:57516849-57516871 CTGGCAAAGCAATAGGAGGATGG + Intergenic
1191177186 X:57516849-57516871 CTGGCAAAGCAATAGGAGGATGG + Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1193673819 X:84422365-84422387 CAGGAAAAGCAGTATTAAGAGGG + Intronic
1193673819 X:84422365-84422387 CAGGAAAAGCAGTATTAAGAGGG + Intronic
1194360676 X:92946483-92946505 CAGGAAAAGCAGTACTAGGAGGG - Intergenic
1194360676 X:92946483-92946505 CAGGAAAAGCAGTACTAGGAGGG - Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1194673369 X:96764099-96764121 CTGGAAAATAAGAATGAGATAGG + Intronic
1194673369 X:96764099-96764121 CTGGAAAATAAGAATGAGATAGG + Intronic
1195849721 X:109270174-109270196 CTGGGATAGCAGTGTGAGGATGG - Intergenic
1195849721 X:109270174-109270196 CTGGGATAGCAGTGTGAGGATGG - Intergenic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196471713 X:116036072-116036094 CTGGAAAAGAAAAATCTGGAGGG - Intergenic
1196471713 X:116036072-116036094 CTGGAAAAGAAAAATCTGGAGGG - Intergenic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199096384 X:143745808-143745830 CTAGAAAGGCAGAATGAGTTTGG - Intergenic
1199096384 X:143745808-143745830 CTAGAAAGGCAGAATGAGTTTGG - Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199892631 X:152102053-152102075 CTGGAAAGGCAGAATAAAGCTGG + Intergenic
1199892631 X:152102053-152102075 CTGGAAAGGCAGAATAAAGCTGG + Intergenic
1200045101 X:153396949-153396971 CCGGAAAACGAGGATGAGGATGG - Intergenic
1200045101 X:153396949-153396971 CCGGAAAACGAGGATGAGGATGG - Intergenic
1200668874 Y:6062298-6062320 CAGGAAAAGCAGTACTAGGAGGG - Intergenic
1200668874 Y:6062298-6062320 CAGGAAAAGCAGTACTAGGAGGG - Intergenic
1200871382 Y:8102279-8102301 TTGGAAAAGCAGTATTAGGGTGG + Intergenic
1200871382 Y:8102279-8102301 TTGGAAAAGCAGTATTAGGGTGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic