ID: 989609688

View in Genome Browser
Species Human (GRCh38)
Location 5:43279130-43279152
Sequence CTCAATAAGATGTGGATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989609688 Original CRISPR CTCAATAAGATGTGGATCTA TGG (reversed) Intronic
901112354 1:6808661-6808683 CTCAATTAGATGTGCATTTCTGG + Intronic
908942367 1:69451053-69451075 ATCAATTAGATGTAGATTTAGGG - Intergenic
909280289 1:73742537-73742559 CATTATAAGATGTGGATCTCCGG + Intergenic
909918943 1:81356330-81356352 ATAAAAAAGATGTGGATCAATGG + Intronic
912071320 1:105813666-105813688 CTGAAGAAGATGTGGAGCAAAGG + Intergenic
913023898 1:114815871-114815893 CTCAATAAAATGTGAAACTTTGG + Intergenic
918954888 1:191194048-191194070 CTGAATAAGATGTGAAGCTCTGG + Intergenic
919601108 1:199623440-199623462 CTCCAGAAGATGTGTATCTATGG - Intergenic
920774725 1:208924907-208924929 TTCAATAAACTGTGGATCCAGGG - Intergenic
921219837 1:212965616-212965638 CTCAATGAGATGAGGATGTGAGG - Intronic
1062988899 10:1796445-1796467 CCAAATAAGATGTGGACCCAAGG - Intergenic
1065892713 10:30134801-30134823 CTCCCCGAGATGTGGATCTAAGG + Intergenic
1074662856 10:115682161-115682183 CACAGTAAGTTGTGGAGCTAGGG - Intronic
1075193267 10:120330758-120330780 CTCAAAAAGCTTTGGATCTGGGG + Intergenic
1079103414 11:17555705-17555727 CTCAATAAGGTGTGAAGCTCAGG + Intronic
1079684160 11:23335784-23335806 CTTAAGAAGATGTGGTTCTGTGG - Intergenic
1079940052 11:26669378-26669400 CTAATTAAGCTGTTGATCTAAGG - Exonic
1080655805 11:34257264-34257286 CTCAGGAAGATGTGGCTCTATGG + Intronic
1084123244 11:67081878-67081900 CTGAATCAGTTGTGGTTCTAAGG + Intergenic
1086419335 11:86622920-86622942 CCCAATAAGAGGTGGAGGTAGGG - Intronic
1086643035 11:89183667-89183689 TTCAATAAGATGTGTTTATATGG + Intronic
1091905231 12:4180858-4180880 CTAAATAATATATGGATCAAAGG + Intergenic
1095247287 12:39937702-39937724 CTGAATCAGATGTGAATTTAAGG - Intronic
1098921018 12:76302296-76302318 TTGAAGAAGATGTGGATTTAAGG - Intergenic
1099034824 12:77573135-77573157 TTTAGTTAGATGTGGATCTAAGG + Intergenic
1099427932 12:82547344-82547366 CTCAATAAACTGGGGATCGATGG - Intergenic
1106964923 13:35052038-35052060 CTCAATATGCAGTGAATCTAAGG + Intronic
1111543253 13:89696488-89696510 CTCAATAAGTTGTGGAGATTTGG + Intergenic
1111692115 13:91577726-91577748 CTCAAAAAGTTGTTGATTTAAGG + Intronic
1121740401 14:96248076-96248098 CTCAAAAAGTTGTGGATTTGGGG - Intronic
1130331283 15:82924225-82924247 ATCAATCAGATGTGGGGCTATGG + Intronic
1138884514 16:61060005-61060027 CTGAAAAAGATGAGGAGCTAAGG + Intergenic
1143175791 17:4954121-4954143 CTCAATATGATTTGGGTGTAGGG - Intronic
1147281617 17:39366617-39366639 ATCAATCAGATGTGAGTCTAAGG - Intronic
1151992338 17:77583977-77583999 GTCAATAAAATGTTGATCTTTGG + Intergenic
1157584594 18:48793001-48793023 CTCCAGAGGATGAGGATCTATGG + Intronic
1164720092 19:30425616-30425638 CTCAGTAAGATCTGGAGCTGTGG - Intronic
1167804350 19:51769460-51769482 CTCAAAGAGATGTTGTTCTATGG + Exonic
929751512 2:44719084-44719106 CTAGATGAGATGTGGATATAAGG - Intronic
932266606 2:70372792-70372814 GTCAACAAGATGTGTATATATGG + Intergenic
933362397 2:81304735-81304757 TTCAATAAGATGTAGAGCAATGG + Intergenic
940342605 2:152597445-152597467 ATCATAAAGATGTGTATCTAGGG + Intronic
940929604 2:159411940-159411962 CTCCAAAATATGTGGATCTGTGG - Intronic
941402765 2:165051288-165051310 CTAAGTAACATGTGGATCAAAGG + Intergenic
942231203 2:173862242-173862264 CTCATCAAGATGTGAATCTCTGG + Intergenic
942429889 2:175899400-175899422 CTAAATAAGATGGGGTACTAGGG - Intergenic
943455898 2:188106380-188106402 CTCAGTACCATGTGGATTTACGG + Intergenic
947473789 2:230423263-230423285 CCCAATAAGAAGAGAATCTAGGG - Intronic
1169184074 20:3597900-3597922 GTCAATAAGAAGAGTATCTATGG - Exonic
1169617384 20:7464086-7464108 CTCAAAAAAATGTAGAGCTATGG + Intergenic
1170291150 20:14769684-14769706 CTCAACCAGATGTGTATGTAAGG - Intronic
1173394781 20:42669181-42669203 CTCAAAAAGATGTGGAGAAAGGG - Intronic
1176259596 20:64172508-64172530 CTCAGTAAAATGTGGTTTTAAGG + Intronic
1177996348 21:28104213-28104235 ATAATTAAGATATGGATCTATGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1183318003 22:37147598-37147620 CACAGTAAGAGGTGGAGCTAGGG + Intronic
950337187 3:12205290-12205312 CTAAATAAGATGCTGGTCTAGGG - Intergenic
959945322 3:112119882-112119904 CTCAACAAGCTGTGGAACTCTGG - Intronic
967988667 3:195115059-195115081 CTCAATAGGAGGAGGATCAACGG - Intronic
970741445 4:19242818-19242840 CTAAGTAAGATGTGATTCTAAGG + Intergenic
974061666 4:57041421-57041443 CTCAAGAAGCTTAGGATCTAAGG + Intronic
974559336 4:63496122-63496144 CTTTATAAGATGGTGATCTAGGG - Intergenic
979318161 4:119291390-119291412 ATTAATACAATGTGGATCTAAGG + Intronic
982708906 4:158739958-158739980 CTCAAAAAGTTTTGGATTTAGGG - Intergenic
989609688 5:43279130-43279152 CTCAATAAGATGTGGATCTATGG - Intronic
992072731 5:73163367-73163389 TTCAATAAGATGGGGTCCTAAGG + Intergenic
993506083 5:88709792-88709814 CCCAACAAGATGTGTATCAATGG + Intergenic
993997423 5:94739394-94739416 CGCAACAACTTGTGGATCTAAGG + Intronic
996903198 5:128567521-128567543 CTCAATAAGATGTTTATGGAAGG + Intronic
998773317 5:145570845-145570867 CTCAATAAGATGGGGAGCTTTGG - Intronic
999434262 5:151550855-151550877 ATCATGAAGATGTGGACCTAGGG + Exonic
999896384 5:156038480-156038502 CTATATAAGATGTTGATCTTAGG + Intronic
1008859035 6:56127025-56127047 CTCAAAGAGATGTGGAGCTTTGG - Intronic
1011813915 6:91166154-91166176 CTCAGGAGGCTGTGGATCTAAGG - Intergenic
1019396930 7:825846-825868 TTCAATAATATGAAGATCTAAGG + Intronic
1020410968 7:7891048-7891070 CTCAATAAAATCTGGATGGATGG + Intronic
1020472415 7:8554121-8554143 CTCAACAAGATGTGGGACTCAGG + Intronic
1020820790 7:12964778-12964800 CTCAAGGAGATGTGGATGTCAGG + Intergenic
1040788480 8:51195776-51195798 CTCACTAAGATGAGGAAATATGG + Intergenic
1040792140 8:51244126-51244148 CTCAAGTAGAGGTGGATCTTTGG + Intergenic
1041117308 8:54552393-54552415 CTCAACAAGATATGGAGCTCTGG + Intergenic
1041866326 8:62578452-62578474 CTCAATAAAATGTGATTCAAGGG + Intronic
1047537399 8:125732421-125732443 TTAAATAGGATGTGGATCTCTGG - Intergenic
1048849255 8:138629109-138629131 GAGAATAAGATGTGGATCCAGGG - Intronic
1051137235 9:13935941-13935963 ATCAATTATATATGGATCTATGG + Intergenic
1059379746 9:113913784-113913806 CTTAATGAGCTGTGGATCTTTGG + Intronic
1059729341 9:117041402-117041424 TTCAATAAGCTGAGGATCTCAGG - Intronic
1059773913 9:117455575-117455597 CTGAATAAGATGTAGAACTGGGG - Intergenic
1060676499 9:125519963-125519985 CTTAATAAAGTGTGTATCTAGGG + Intronic
1187006095 X:15233927-15233949 CTCAATAATCTGTGGATTGAAGG - Intergenic
1188242017 X:27804497-27804519 GTCAATAGGATCTGGAACTAAGG - Intergenic
1190653197 X:52587547-52587569 TTTAATAAGATGTGCATTTAAGG - Intergenic
1190954357 X:55177545-55177567 TTTAATAAGATGTGCATTTAAGG - Intronic
1191064493 X:56333228-56333250 CTCAATAAACTATGTATCTAAGG - Intergenic
1194524711 X:94965631-94965653 CTCTATAATATGTGGAACCAAGG + Intergenic
1194524720 X:94965681-94965703 CTCCATAATATGTGGAACCAAGG + Intergenic
1195301466 X:103534078-103534100 ATGAATGAGATGTGGATTTAGGG + Intergenic
1195592352 X:106644443-106644465 CTCAAAAAGCTGTGGATAGAAGG - Intronic
1200222924 X:154400696-154400718 TTCTTTGAGATGTGGATCTAAGG - Exonic