ID: 989618378

View in Genome Browser
Species Human (GRCh38)
Location 5:43359988-43360010
Sequence CTCAGGATTCAGGGTTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989618369_989618378 3 Left 989618369 5:43359962-43359984 CCTGCCCACCAAATTATCCATAA No data
Right 989618378 5:43359988-43360010 CTCAGGATTCAGGGTTCTCAGGG No data
989618363_989618378 18 Left 989618363 5:43359947-43359969 CCCATTCCCTAGTCCCCTGCCCA No data
Right 989618378 5:43359988-43360010 CTCAGGATTCAGGGTTCTCAGGG No data
989618372_989618378 -5 Left 989618372 5:43359970-43359992 CCAAATTATCCATAAAAACTCAG No data
Right 989618378 5:43359988-43360010 CTCAGGATTCAGGGTTCTCAGGG No data
989618367_989618378 5 Left 989618367 5:43359960-43359982 CCCCTGCCCACCAAATTATCCAT No data
Right 989618378 5:43359988-43360010 CTCAGGATTCAGGGTTCTCAGGG No data
989618366_989618378 11 Left 989618366 5:43359954-43359976 CCTAGTCCCCTGCCCACCAAATT No data
Right 989618378 5:43359988-43360010 CTCAGGATTCAGGGTTCTCAGGG No data
989618368_989618378 4 Left 989618368 5:43359961-43359983 CCCTGCCCACCAAATTATCCATA No data
Right 989618378 5:43359988-43360010 CTCAGGATTCAGGGTTCTCAGGG No data
989618364_989618378 17 Left 989618364 5:43359948-43359970 CCATTCCCTAGTCCCCTGCCCAC No data
Right 989618378 5:43359988-43360010 CTCAGGATTCAGGGTTCTCAGGG No data
989618370_989618378 -1 Left 989618370 5:43359966-43359988 CCCACCAAATTATCCATAAAAAC No data
Right 989618378 5:43359988-43360010 CTCAGGATTCAGGGTTCTCAGGG No data
989618365_989618378 12 Left 989618365 5:43359953-43359975 CCCTAGTCCCCTGCCCACCAAAT No data
Right 989618378 5:43359988-43360010 CTCAGGATTCAGGGTTCTCAGGG No data
989618371_989618378 -2 Left 989618371 5:43359967-43359989 CCACCAAATTATCCATAAAAACT No data
Right 989618378 5:43359988-43360010 CTCAGGATTCAGGGTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989618378 Original CRISPR CTCAGGATTCAGGGTTCTCA GGG Intergenic