ID: 989621575

View in Genome Browser
Species Human (GRCh38)
Location 5:43389662-43389684
Sequence CCAGTTTACTAAGTATATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989621575_989621580 24 Left 989621575 5:43389662-43389684 CCTATATATACTTAGTAAACTGG 0: 1
1: 0
2: 0
3: 14
4: 166
Right 989621580 5:43389709-43389731 AAACGTAGGATGGGCTCAGCTGG 0: 1
1: 0
2: 2
3: 11
4: 131
989621575_989621579 15 Left 989621575 5:43389662-43389684 CCTATATATACTTAGTAAACTGG 0: 1
1: 0
2: 0
3: 14
4: 166
Right 989621579 5:43389700-43389722 TATTAATATAAACGTAGGATGGG 0: 1
1: 0
2: 0
3: 10
4: 172
989621575_989621578 14 Left 989621575 5:43389662-43389684 CCTATATATACTTAGTAAACTGG 0: 1
1: 0
2: 0
3: 14
4: 166
Right 989621578 5:43389699-43389721 ATATTAATATAAACGTAGGATGG 0: 1
1: 0
2: 0
3: 13
4: 231
989621575_989621577 10 Left 989621575 5:43389662-43389684 CCTATATATACTTAGTAAACTGG 0: 1
1: 0
2: 0
3: 14
4: 166
Right 989621577 5:43389695-43389717 TCAAATATTAATATAAACGTAGG 0: 1
1: 0
2: 3
3: 38
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989621575 Original CRISPR CCAGTTTACTAAGTATATAT AGG (reversed) Intronic
901288469 1:8102546-8102568 TCAATTTACTAGGTATATGTGGG - Intergenic
907143420 1:52210224-52210246 CCATTTTACTACTTATATATTGG - Intronic
908269366 1:62408085-62408107 CCAGTTTACTAATTAACTAAAGG - Intergenic
909475981 1:76081429-76081451 CCAATTTAGTAAATATTTATAGG + Intronic
911433698 1:97826540-97826562 GCAGTTTTCCAAGTAAATATTGG + Intronic
911637743 1:100254195-100254217 ATAGTTGACTAAGCATATATTGG - Intergenic
912019307 1:105086879-105086901 CCTGTATACTAAATATACATTGG - Intergenic
914743614 1:150485322-150485344 CAAATTTACTCAGTAAATATGGG - Intergenic
915685775 1:157631618-157631640 GCATTTTACTCAGTAAATATAGG + Intergenic
915787412 1:158630337-158630359 CCAGTTAACTACATATACATGGG - Intronic
918842277 1:189557414-189557436 ACAGTTTACTAATTACACATTGG + Intergenic
921883978 1:220285928-220285950 CCAGTTTATTAATTATCTTTTGG + Intergenic
921966159 1:221092433-221092455 CCATCTTACTATGTTTATATTGG + Intergenic
924191513 1:241557633-241557655 CCAGTTTGCTAGGTATATTCAGG + Intronic
1064482975 10:15758035-15758057 CCATTCTACTAGGTATATATTGG + Intergenic
1065084033 10:22156357-22156379 ACATTTTAATAAGTATATCTGGG + Intergenic
1066671276 10:37842826-37842848 CTAATTTTCTCAGTATATATGGG - Intronic
1067960413 10:50841605-50841627 CCTGTTTCATAAATATATATTGG - Intronic
1069922011 10:71821446-71821468 CCTGTATACTAAGTACATGTGGG - Intronic
1070755641 10:78991401-78991423 CCATTTTACTAGATATGTATGGG - Intergenic
1073963499 10:108961267-108961289 TCAGTTTAGTAAGTATTTATTGG + Intergenic
1079072512 11:17359822-17359844 CCATTTTAATAAGTATATAGTGG + Intronic
1080339022 11:31235351-31235373 CCATTTTTCTAAGTTTATAGAGG - Intronic
1080528984 11:33155440-33155462 CAAGTTTACTAAGCAGATAATGG - Intronic
1083981120 11:66171185-66171207 ACATTTTATTAAGTTTATATAGG + Intronic
1084140387 11:67224180-67224202 CCCGTTTACAAACTCTATATCGG - Intronic
1085106525 11:73848274-73848296 CCAGTTGACCATGTATATGTGGG + Intronic
1086431787 11:86743207-86743229 CCAGTTTACTCAGTGTAGCTCGG + Intergenic
1086436397 11:86785247-86785269 AAAGTTTACTAAGTGTTTATGGG - Intergenic
1086459654 11:86993952-86993974 TCAGTTTATTATGTATATGTTGG + Intergenic
1088178201 11:107078496-107078518 CCATTCTAATAAGTATATAGTGG + Intergenic
1088359297 11:108974194-108974216 CCCTTTTACTAAGTGTATAAAGG + Intergenic
1089032073 11:115341898-115341920 CCAATTCACTAAGTTTGTATTGG - Intronic
1089154010 11:116386594-116386616 CCAGTTAACTAAGTATCTCTGGG - Intergenic
1093154231 12:15661815-15661837 CAAGTCTACTAACTAAATATTGG + Intronic
1094437963 12:30442374-30442396 TGAGTTTACAAAGTACATATTGG - Intergenic
1100072908 12:90743182-90743204 CCTGTGTACTAGGTATATAAGGG + Intergenic
1101572700 12:105969507-105969529 CCACTTTAATAGGTATGTATTGG - Intergenic
1103055267 12:117814846-117814868 CCAGCTGAATAAGTATCTATAGG + Intronic
1104171653 12:126287409-126287431 CCAATACACTAAATATATATGGG - Intergenic
1106131270 13:26941444-26941466 CCAGTTTCCTAAGTCTGTGTTGG - Intergenic
1106278542 13:28240106-28240128 CTAGTTTAGTGAGTATATTTTGG + Intronic
1107288179 13:38820429-38820451 GCAGTTTACTAAACATTTATAGG + Intronic
1111580249 13:90213385-90213407 CCAATTTACCATCTATATATTGG - Intergenic
1111751572 13:92338244-92338266 CCATTCTAATACGTATATATTGG - Intronic
1112604145 13:100887682-100887704 ACAGCTCATTAAGTATATATGGG - Intergenic
1115178989 14:30600074-30600096 CCAGTTTACAAAATTTATATAGG + Intronic
1117135736 14:52732571-52732593 CCTGTTTTCTAAGAGTATATTGG - Intronic
1118696781 14:68393753-68393775 CCAGGTCACTAAATATATTTAGG + Intronic
1119096390 14:71835874-71835896 CCATTCTAATAAGTATATAGTGG + Intergenic
1119146709 14:72322909-72322931 CCATGTTACTAAGTATGTATTGG - Intronic
1119966255 14:78919024-78919046 CTAGTTTACCAATTATATTTGGG - Intronic
1120004212 14:79338438-79338460 CCAGTGTACTTAGTAGAGATAGG + Intronic
1120047386 14:79823282-79823304 CAAATTTACTGAGTATTTATTGG + Intronic
1121479394 14:94250826-94250848 CAAACTCACTAAGTATATATAGG - Intronic
1124246519 15:28075375-28075397 CCATTTTAATAAGTATTTAGAGG - Intronic
1125416226 15:39456128-39456150 GAAGTTTACTAAGTATTTGTAGG - Intergenic
1126317760 15:47388581-47388603 GTAGTATACTTAGTATATATAGG + Intronic
1126642144 15:50839092-50839114 TCAGTTGACTATGTTTATATGGG + Intergenic
1127442498 15:59023984-59024006 TCAGTTTACCAATAATATATAGG + Intronic
1131772534 15:95754491-95754513 CCCTTTTACTTTGTATATATTGG + Intergenic
1134423922 16:14120588-14120610 TCAGTTTCCTTAGTATACATGGG + Intronic
1138405962 16:56794292-56794314 CCAGTTTTTTAAGTATGTAATGG + Intronic
1139138141 16:64230006-64230028 GGAGTTTATTAAGTATATATAGG - Intergenic
1146707755 17:35013971-35013993 CCATTTTACTAAATAAATTTGGG + Intronic
1149225608 17:54466318-54466340 CCATTTTATTAAGCATAAATGGG - Intergenic
1149397484 17:56259847-56259869 CCATTCTACCAGGTATATATAGG + Intronic
1152478733 17:80536066-80536088 CCAGTTTGCATATTATATATTGG + Intergenic
1153107823 18:1548797-1548819 CCAGTTAACTAAGAATTAATGGG - Intergenic
1153587843 18:6641902-6641924 CCAGTTCAGTAGGTATATAATGG + Intergenic
1154114975 18:11605945-11605967 TCAGTTTTCTTAGTAGATATAGG - Intergenic
1162274953 19:9645751-9645773 CAAGTGTAGTAAGTGTATATGGG + Intronic
1162514603 19:11140365-11140387 CCACATTTCTAAGTAAATATGGG + Intronic
1164508841 19:28881361-28881383 CCAGTTTATTAAGAAAGTATAGG - Intergenic
927336401 2:21929678-21929700 CCAGTTATGTAAGTATGTATTGG - Intergenic
927397168 2:22665835-22665857 CCAGTTGTCCATGTATATATAGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928081416 2:28315803-28315825 TCAGTTTACAAATTACATATTGG + Intronic
928891827 2:36213198-36213220 CCAGTTTAGTCCGTATATGTGGG + Intergenic
931595094 2:63932899-63932921 TCAGTATACTAAGGTTATATAGG + Intronic
933212714 2:79589419-79589441 ACATTTTATTAAGTATATAAAGG - Intronic
935032847 2:99338537-99338559 TAAGTTTACTAATTATAAATTGG + Intronic
935231855 2:101105674-101105696 CCATTCTATTAAGTATATAATGG - Intronic
937481937 2:122270646-122270668 CCATTCTAATAAGTATGTATTGG + Intergenic
939294933 2:140249516-140249538 CTATTTTACTTATTATATATTGG + Intronic
939910118 2:147971558-147971580 CCATTCTAATAGGTATATATTGG - Intronic
940900659 2:159123593-159123615 CCACTGTACTGAGTAAATATTGG + Intronic
941014931 2:160344840-160344862 CCAGTTTAATAAGCTTTTATTGG - Intronic
941626172 2:167832964-167832986 TCAGTTTGCTAAGTAGAAATGGG + Intergenic
941919590 2:170836474-170836496 TCATTTTACTATATATATATTGG + Intronic
943383761 2:187178566-187178588 CCAGTTCAATCAGTATATAAAGG - Intergenic
944830814 2:203533009-203533031 CCAATCTAGTAAGTATTTATGGG + Intronic
945043473 2:205762197-205762219 CCAGTTTAGTATGCGTATATGGG - Intronic
945115811 2:206406812-206406834 CCAGTTTACACAGTATAGAAAGG - Intergenic
945473147 2:210250362-210250384 TCAGTTTATTAAGTAAATACAGG + Intergenic
945793902 2:214338049-214338071 CCACTTTAAAAATTATATATAGG + Intronic
946969182 2:225073116-225073138 CTAGTTTACTAAGTCTGGATGGG - Intergenic
947491549 2:230599753-230599775 CTAGTTGACCATGTATATATGGG - Intergenic
947576287 2:231277458-231277480 TCAGTCTACAAAGTATATAGAGG - Intronic
1170182860 20:13552826-13552848 TTAGTGTACTAAGTAAATATTGG + Intronic
1170778894 20:19405502-19405524 CCAGGGTACTAAGTACATTTTGG - Intronic
1172429864 20:34880719-34880741 CTAGTTTTCTAGGTATATAATGG + Intronic
1177375924 21:20270859-20270881 ACCGTTTCCTATGTATATATTGG + Intergenic
1177684218 21:24416524-24416546 CAAGTTTACTAAGAAAATAAAGG - Intergenic
950355933 3:12409210-12409232 CCAGTTTGGTAAGCAAATATTGG - Intronic
950981323 3:17308565-17308587 GCAGTTTTCTAAGTTTCTATTGG - Intronic
954725987 3:52611104-52611126 CCAGTTTTCAAAATATGTATTGG - Intronic
954764853 3:52905535-52905557 TCAGTTTACTAAATTTCTATGGG - Intronic
954942355 3:54385674-54385696 CCAGTTTAATAATTATTCATGGG + Intronic
957168234 3:76703332-76703354 ACAGGGTACTAAGTAAATATTGG - Intronic
957951978 3:87139310-87139332 CCAATATACTAAATATATTTGGG + Intergenic
958670606 3:97198960-97198982 CCAGTTTCCCAAGTAAGTATAGG + Intronic
959305542 3:104660482-104660504 TAAGTTTGCTAAGTATAAATAGG + Intergenic
965176405 3:165339858-165339880 CCAGATTAACAAGTATATTTTGG - Intergenic
966102886 3:176295009-176295031 AAAATTCACTAAGTATATATAGG + Intergenic
967800545 3:193653856-193653878 CCATTTTAGTAAGTTTATAGTGG - Intronic
974979907 4:68942563-68942585 CCATTTCATTAAATATATATTGG + Intronic
977888978 4:102284873-102284895 CCAGGTTACAAAATATATATTGG - Intronic
979324304 4:119361211-119361233 ATAGTTTACTAAATATTTATGGG + Intergenic
979667211 4:123325452-123325474 TCAGTTTGTTAAGTATATGTTGG + Intergenic
980383295 4:132055575-132055597 CCAGTTTAGAAAGTAAACATAGG - Intergenic
980459555 4:133090047-133090069 ACTGTTTCCAAAGTATATATAGG + Intergenic
982889392 4:160828183-160828205 AGAGTTTCCTAAGAATATATAGG - Intergenic
983242144 4:165245910-165245932 ATAGTTTACTAAATATTTATGGG + Intronic
983611500 4:169650525-169650547 CCAGTTTAGAAAGTATAGAATGG + Intronic
984379547 4:178973317-178973339 CCATTTTACTAAATAGATAATGG + Intergenic
986951787 5:13096801-13096823 TCAGTTGACTATGTATATGTGGG - Intergenic
987835031 5:23149685-23149707 CTAATTTACTATGTATATTTAGG + Intergenic
987997487 5:25304455-25304477 ACACTTTACTAAAAATATATTGG - Intergenic
988651726 5:33159342-33159364 ATAGTTTTCTAAGTATTTATTGG - Intergenic
989621575 5:43389662-43389684 CCAGTTTACTAAGTATATATAGG - Intronic
989784136 5:45306904-45306926 CCAGATTATTAAGTTTATGTTGG + Intronic
991119134 5:62990812-62990834 CCAGTTGACTATATTTATATAGG + Intergenic
992971755 5:82067732-82067754 CAAGTTGACTAAATATACATAGG + Intronic
994291987 5:98038078-98038100 CAAGTTTCCTATGTAAATATTGG - Intergenic
996790442 5:127288546-127288568 CCATTCTAGTAAGTATATAGTGG - Intergenic
998051304 5:139038346-139038368 CCAGTATACTAAGCCTAAATAGG - Intronic
1000086920 5:157895770-157895792 CCAGTTTACAGAGAATATAGAGG - Intergenic
1003800536 6:9660344-9660366 TCAGTTTAGTAAGAATGTATTGG - Intronic
1008749451 6:54714689-54714711 ACAGGTTACTAAGTAAATACTGG + Intergenic
1009625228 6:66130928-66130950 CCAACTTACTAAGTACACATAGG - Intergenic
1010277580 6:73987825-73987847 CTAGTTTTCTCAGTATATTTTGG - Intergenic
1010952321 6:82051339-82051361 TCAGTTTACCATGTATATATAGG + Intergenic
1011516231 6:88156741-88156763 CCTGTTTACTAAGTAAATGTTGG + Intronic
1016467910 6:144345234-144345256 CCAATTCACTAAGAAAATATGGG - Intronic
1017661314 6:156676859-156676881 CCATTTTAATAGGTATATAGTGG - Intergenic
1019267083 7:123782-123804 CCTGTTTTCTAAGTGGATATCGG - Intergenic
1021042992 7:15886986-15887008 CCAGTTAACTAATTATCCATAGG - Intergenic
1023644795 7:42299532-42299554 CCACTTTACTAAAATTATATGGG - Intergenic
1028658656 7:93240493-93240515 TCAGTTTACAAATTTTATATAGG + Intronic
1030311655 7:108074830-108074852 CCCATTCACTGAGTATATATGGG - Intronic
1031338467 7:120568335-120568357 ACATTTTGCTAAGTATAAATAGG - Intronic
1033806049 7:144955265-144955287 CCAGTTTATTAGGTATGGATGGG + Intergenic
1037477654 8:19272989-19273011 CAAGTCTACTAATTATACATGGG - Intergenic
1037693092 8:21199592-21199614 CCTGTTTACTAAGGAAATATGGG - Intergenic
1040970670 8:53133969-53133991 CCAGTTAAGGAACTATATATAGG + Intergenic
1041091425 8:54304670-54304692 CTAGTTTCCTAAATATATCTAGG + Intergenic
1041750694 8:61257902-61257924 CTAGTTTACAAAATATGTATTGG + Intronic
1041880162 8:62740306-62740328 CTGGTTTCTTAAGTATATATGGG + Intronic
1045795766 8:106041824-106041846 CCATTTTACTAAGTATGAAGTGG + Intergenic
1046549279 8:115692891-115692913 CCAGTTTACAAAGTATTTTAAGG - Intronic
1047705039 8:127489821-127489843 ACAGTTTATGAAGTATATAAAGG + Intergenic
1048226142 8:132587658-132587680 CTAATTTACTAAGCATATTTTGG - Intronic
1051307407 9:15727307-15727329 CCAGTTTACTTACTACTTATAGG - Intronic
1052023502 9:23550514-23550536 GCAGTTTTCTAACTAAATATAGG - Intergenic
1052065439 9:24013044-24013066 TCAGTTTACTGAGTATCTATAGG - Intergenic
1054866073 9:70002861-70002883 CCACTCTACTAGGTATATAGTGG + Intergenic
1055815411 9:80199319-80199341 CCAATTTACTAGCTATTTATTGG + Intergenic
1056182234 9:84096463-84096485 CCAGGCTATTAAATATATATCGG + Intergenic
1057158784 9:92869865-92869887 CAATTTGACTAAGTAAATATAGG + Intronic
1058343691 9:103930802-103930824 ACAGTCTACTAAGAAGATATGGG + Intergenic
1187622363 X:21071830-21071852 CCAATTTAATAATGATATATGGG - Intergenic
1188754197 X:33940600-33940622 GAATTTTACTTAGTATATATTGG + Intergenic
1189842196 X:45092504-45092526 CCAATTTCCTAAATATATTTAGG + Intronic
1193856464 X:86609970-86609992 CCAGGTCATTAAGTAAATATGGG - Intronic
1194861120 X:98999892-98999914 ACAGTTTACTTAGTTTATGTTGG + Intergenic
1195386312 X:104316673-104316695 CCAATTCACCAAGTATATCTGGG - Intergenic
1196294166 X:113979826-113979848 CCAGATTACAAAGAATATAGGGG - Intergenic
1196656534 X:118224024-118224046 CCAGTTTCCTTAATATATAAAGG + Intergenic
1201751722 Y:17439488-17439510 CAGGTTTACTAAGTATACATAGG - Intergenic
1202027162 Y:20536482-20536504 CCAATTTACTTTGTATGTATTGG + Intergenic