ID: 989627785

View in Genome Browser
Species Human (GRCh38)
Location 5:43448224-43448246
Sequence CAAAATGTGGAGGAGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 484}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989627785 Original CRISPR CAAAATGTGGAGGAGAAGGC AGG (reversed) Intronic
900799770 1:4729973-4729995 CACAATGGGGAGTAGAAGGAAGG - Intronic
901236445 1:7669961-7669983 CAGAAAGTGGAGGAGGAGGGTGG - Intronic
904361109 1:29972392-29972414 TTTGATGTGGAGGAGAAGGCTGG - Intergenic
904409391 1:30315921-30315943 CAGAAGGGGGAGGAGAAGGGAGG - Intergenic
904866335 1:33581924-33581946 CAAACTGTGAAGGGAAAGGCTGG + Intronic
904930820 1:34086273-34086295 CAAAATCTGATGGAGAAGACTGG + Intronic
905275108 1:36812464-36812486 CAAAATGTAAAGGAGAACGTTGG - Intronic
905292942 1:36935414-36935436 CCAAATGTGGTGGAGAATTCTGG - Intronic
905640693 1:39587761-39587783 AAAAAAGTGGAAGAGAAGGTTGG - Intergenic
905908675 1:41638973-41638995 AAGAAAGTGGAGAAGAAGGCTGG + Intronic
906632888 1:47387360-47387382 CAAAATGGTGAGGAGAGGCCAGG + Intergenic
906930890 1:50168215-50168237 CAAACTGGGGAAGAGAAGGCAGG + Intronic
907124322 1:52035763-52035785 CATAAGGAGGAGGAAAAGGCAGG - Intronic
907700271 1:56779645-56779667 CAAAATGATGGGGAGAAGGATGG - Intronic
908355356 1:63322187-63322209 CAAAGTGGGGGGGAGAAGGGCGG + Intergenic
908645308 1:66272018-66272040 CAAAGGGTGGAGGAGGAAGCTGG + Intronic
909494432 1:76262659-76262681 GGAAATGTGGAGGAGAAAGATGG + Intronic
909760548 1:79280709-79280731 CAAGATGGAGAGGAGAAGCCTGG - Intergenic
910756965 1:90704495-90704517 AAAAATCAGGAGGACAAGGCAGG + Intergenic
911065319 1:93782619-93782641 CAAACAGTGGAGGATAAGGAAGG + Intronic
911257294 1:95647069-95647091 CAGACTGGGGAAGAGAAGGCAGG + Intergenic
911380366 1:97106594-97106616 CAGATGGTGGAGGAGATGGCTGG - Intronic
911991270 1:104699679-104699701 CAAAAGGTGGAGGAGGTGGAAGG - Intergenic
912199999 1:107446063-107446085 AAGAATGTGAAGCAGAAGGCAGG + Intronic
912257971 1:108080524-108080546 GAAAAGATGGAGGAGAAGGATGG - Intergenic
912512944 1:110200890-110200912 CAAGAGGAGGAGGAGGAGGCAGG - Exonic
914766390 1:150641235-150641257 CGAATTGAGGAGGGGAAGGCTGG - Intergenic
915128593 1:153681947-153681969 AAAGCTGTGGAGGAAAAGGCTGG - Intronic
915240990 1:154521578-154521600 CTGACTGTGGAGAAGAAGGCAGG + Intronic
915509691 1:156379823-156379845 AACAAGGTGAAGGAGAAGGCTGG - Intronic
915922115 1:159983803-159983825 CAAAATGCGAAGCAAAAGGCAGG + Intergenic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916664484 1:166953484-166953506 CAAAATGGGGAGCAGAAAACAGG - Intronic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
917433843 1:174999540-174999562 AAAAATGGGGAGGAGCAGCCTGG - Intronic
917612231 1:176700258-176700280 CAATATCTGGAGCAGGAGGCTGG + Intronic
917634176 1:176918904-176918926 AAACCTGTGGTGGAGAAGGCTGG - Intronic
919718489 1:200806429-200806451 AAAAATGTGGAGAAACAGGCAGG + Intronic
919919809 1:202161168-202161190 CACAATGTGAAGGAAAGGGCCGG + Exonic
920540599 1:206774952-206774974 CAAAATGTCAGGGAGAAGGGAGG + Intergenic
921179523 1:212620835-212620857 CATAATGGGGAGGGAAAGGCAGG - Intergenic
921458055 1:215395410-215395432 AAAAATGAGGAGGAGTTGGCTGG - Intergenic
921986325 1:221316883-221316905 CTTTATGTGGATGAGAAGGCAGG - Intergenic
924291020 1:242536503-242536525 CAAAATGTGTACATGAAGGCAGG - Intergenic
924381937 1:243473687-243473709 TGAAATATGGAGGAGAAAGCGGG + Intronic
924780633 1:247144288-247144310 TAAAATGTCTAGGAGAAGGTAGG - Intronic
1063225759 10:4013414-4013436 CAAAGTGGGGAGGAGAAGGAAGG - Intergenic
1063282517 10:4645769-4645791 CTGAATGTGGAGGAGGAGCCAGG - Intergenic
1064311535 10:14216372-14216394 TCAAAAGTGGAAGAGAAGGCTGG + Intronic
1065134337 10:22653325-22653347 AAAGAGGTGGAGGAGAAGGAAGG - Intronic
1065210985 10:23402799-23402821 GAAAAGCTGGAGGAGCAGGCAGG + Intergenic
1066046289 10:31598352-31598374 CAGAATGTGGGAGAGAAGCCAGG + Intergenic
1067203132 10:44192239-44192261 AAAAATGAAGAGGAGAAGGATGG + Intergenic
1068542406 10:58309907-58309929 CTAAATGTTGAGGAGAATGAGGG + Intergenic
1069126952 10:64647438-64647460 TAAAATGAGTAAGAGAAGGCAGG + Intergenic
1069522949 10:69140361-69140383 CAAAAAGTTCAGGAGAAGGTCGG - Intronic
1069780839 10:70954401-70954423 GAAGATGAGGAGGAGGAGGCCGG - Intergenic
1070104576 10:73419174-73419196 CTACATGTGGAGGGGAAGGATGG - Intergenic
1070219332 10:74423918-74423940 GACAAAGTGGAGGACAAGGCTGG + Intronic
1071335993 10:84601001-84601023 CAGAATTTGGAGGAGCTGGCAGG - Intergenic
1071412259 10:85408268-85408290 CCAAAGCTGGAGGAGAAGGCTGG + Intergenic
1072209224 10:93231388-93231410 CAGGCTGGGGAGGAGAAGGCAGG + Intergenic
1072993687 10:100224002-100224024 CAGAATGTGGTGGAAAAGGATGG + Intronic
1073321984 10:102621117-102621139 CCAAATGGGTAGCAGAAGGCAGG - Intronic
1073465106 10:103690440-103690462 CAAAATGTGATGGGGGAGGCCGG + Intronic
1073835436 10:107435812-107435834 TAAAACGTGGAGGAGAAGAGGGG + Intergenic
1074855708 10:117471948-117471970 AAATGTGTGGAGGAGAAGGCAGG + Intergenic
1074858424 10:117490816-117490838 AAAGATGTGGAGGAGAAGCCGGG - Intergenic
1074934766 10:118166964-118166986 CAAAAAGGGCAGGAGAAGACGGG + Intergenic
1075222767 10:120599154-120599176 AGAGATGTGGAGGAGAAGCCAGG + Exonic
1075268080 10:121023079-121023101 CAGAATGTAGAGCAAAAGGCAGG - Intergenic
1076188156 10:128464624-128464646 CCTAATGAGGAGGGGAAGGCAGG - Intergenic
1076245972 10:128948171-128948193 TACAATGTGGAGGTGATGGCAGG - Intergenic
1076455133 10:130587230-130587252 GAAGATGTGAAGGAGATGGCAGG - Intergenic
1077027488 11:447616-447638 AAAACTGTGGCAGAGAAGGCCGG - Intergenic
1077510798 11:2961227-2961249 AGAAAGGTGGAGGAGGAGGCGGG + Intronic
1078616467 11:12870587-12870609 CAAAATATCTAGGACAAGGCTGG + Intronic
1078949215 11:16109875-16109897 CAAACTGTGTTGGATAAGGCAGG - Intronic
1079061329 11:17251522-17251544 CAGGAGGTGGAGGAGAAGACAGG + Intronic
1079142742 11:17823582-17823604 CAAACGGGGGAAGAGAAGGCGGG + Intronic
1081574970 11:44313363-44313385 CAAATTGTGGTGGAGAGGGTTGG + Intergenic
1082193759 11:49277384-49277406 CAAAATTTGGAGGTGAAAGCAGG + Intergenic
1082825266 11:57573049-57573071 AAAAATGAGGGTGAGAAGGCCGG + Intergenic
1083192321 11:61061198-61061220 CAAAACGTGCCGGAGTAGGCTGG + Intergenic
1083514350 11:63242907-63242929 CAGAAGGTGGAGGAGAAGAGAGG - Intronic
1084389616 11:68866488-68866510 GAATCTGGGGAGGAGAAGGCAGG - Intergenic
1084505178 11:69562197-69562219 TAAAACTTGGAGGGGAAGGCAGG - Intergenic
1085046250 11:73355514-73355536 AGAACTGTGGAGGAGGAGGCAGG - Exonic
1085803687 11:79614837-79614859 CAAAATGGTGAGGAGAAGCAAGG - Intergenic
1086153340 11:83638175-83638197 AAAAATGTGGAGGAGAAAATGGG - Intronic
1086672381 11:89563673-89563695 CAAAATTTGGAGGTGAAAGCAGG - Intergenic
1086781319 11:90909949-90909971 CAGAATGTGAAGGGGGAGGCAGG + Intergenic
1087496451 11:98896022-98896044 GAAAATTTGGAGGAGGAGGAAGG + Intergenic
1088221067 11:107570405-107570427 CAACATTTGGATGCGAAGGCAGG + Intergenic
1088632284 11:111785254-111785276 CAACATGTGGTAGACAAGGCAGG - Intronic
1090144216 11:124302238-124302260 TGAAATGAGGAAGAGAAGGCAGG + Intergenic
1090209462 11:124907784-124907806 CAAGCTGGGGAAGAGAAGGCAGG + Intergenic
1091074195 11:132599423-132599445 AAGAAGGTGGAGGAGAAGGAAGG + Intronic
1091147057 11:133289253-133289275 CAAAACATGAAGGAGAAGTCAGG - Intronic
1091640679 12:2234820-2234842 CAAGAGGTGGAGGAGAGGGAGGG + Intronic
1091962918 12:4714021-4714043 CAGAACGTGGAGGCGGAGGCGGG - Intronic
1092393609 12:8104524-8104546 AAAGATATGGTGGAGAAGGCAGG - Intergenic
1092679219 12:10958889-10958911 AAAAATCTGGAGGAGAAGAATGG + Intronic
1092731926 12:11542861-11542883 AAAAAAATGGAGGAGAAGGTGGG + Intergenic
1093417988 12:18942434-18942456 CAATAGGTGGAGAAGAAGGAAGG + Intergenic
1093711110 12:22331043-22331065 CAAACTGCGAAGGAGATGGCAGG - Intronic
1094143687 12:27206713-27206735 TAAAATGTAAAGGAGAGGGCGGG - Intergenic
1095054346 12:37582050-37582072 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1095854170 12:46842380-46842402 CATAGTGTGGAGGAGGAGGAGGG + Intergenic
1096662093 12:53132113-53132135 CAGACTGTGGGGGAGAAGGGAGG + Intergenic
1096801635 12:54114299-54114321 CAGGATGGTGAGGAGAAGGCAGG + Intergenic
1098197210 12:68014708-68014730 CAAAATCTGATGGAGAAGGTTGG - Intergenic
1099110969 12:78560537-78560559 CAATGTGTGTAGGGGAAGGCAGG - Intergenic
1100280500 12:93113762-93113784 AAAAATGTGGAGGGGAGGGGTGG + Intergenic
1100715469 12:97301150-97301172 AAAAATGTGGAAGGGAAGGCAGG - Intergenic
1100727204 12:97421193-97421215 CAAAAGGATGAGGAGAAGGAAGG + Intergenic
1101607153 12:106256184-106256206 CAAACTGTGAAGGGGAAGGCAGG + Intronic
1101723496 12:107371007-107371029 CAAAGGGAGGAGGAGAAGGGGGG - Intronic
1102062652 12:109945288-109945310 GAAAGTGTGGAGGGGAAGGAAGG + Exonic
1102321656 12:111941079-111941101 TAAAATATGGAAGAGTAGGCCGG + Intronic
1102341406 12:112124838-112124860 CAAAATATGGAGGCCAAGGCGGG - Intergenic
1102827433 12:115961308-115961330 CACAAAGTGGACGGGAAGGCAGG + Exonic
1102965397 12:117121397-117121419 CAAAAAGTGGGGGGGAAGGCAGG + Intergenic
1103482242 12:121258318-121258340 AAAAAGGTGGAGGAGGGGGCTGG - Intronic
1103804608 12:123562702-123562724 CAAAAGGAGGGGGAGCAGGCCGG + Intergenic
1105261401 13:18782348-18782370 TAAAGTGGGGAGGAGTAGGCTGG - Intergenic
1105974155 13:25458634-25458656 CAGAAGGTGGAGTGGAAGGCAGG + Intronic
1105991726 13:25628675-25628697 CAGAAGCTGGAGGAGAAGCCTGG - Intronic
1108249791 13:48552498-48552520 CAGAATGTGGATGTGATGGCTGG + Intergenic
1108585447 13:51866392-51866414 CAAAATGGGGAGGAGAGGCTCGG + Intergenic
1108586533 13:51874848-51874870 CAAATTGTGGAGGAGGAGGGAGG - Intergenic
1109294201 13:60510624-60510646 CTAAAGGTAGAGGAAAAGGCAGG + Exonic
1110094837 13:71504636-71504658 CAGAATGTTCAGGAGAAGGTTGG + Intronic
1110672445 13:78197167-78197189 CTAAATGTAGGGGAGAAGTCAGG - Intergenic
1112311086 13:98318051-98318073 AAAAAGGAGGAGGAGAAGGAAGG - Intronic
1112470024 13:99679716-99679738 CAAAATGGGAAGGAGAGGGTGGG + Intronic
1112615537 13:101001412-101001434 CACGATGGGGAGGAGAAGACTGG - Intergenic
1112682974 13:101788172-101788194 AAAAAAGTGGAGGAGGGGGCAGG - Intronic
1112855022 13:103757892-103757914 CCAGAGGTGGAGGAGGAGGCAGG - Intergenic
1113258650 13:108535097-108535119 AAAAAGGAGGAGGAGAAGGAGGG - Intergenic
1113312914 13:109149714-109149736 GAAAAAGAGGAGGAGAAGGCAGG - Intronic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1114667846 14:24391019-24391041 CAAAAAGTGGAGGAGGAGGATGG + Intergenic
1115340175 14:32285383-32285405 CAAGATGTGGGGGATAAGGCTGG + Intergenic
1116434783 14:44884959-44884981 GAAAATATGGAGTAGAAGGATGG + Intergenic
1116942984 14:50809336-50809358 CAGATCCTGGAGGAGAAGGCAGG - Intronic
1117220114 14:53595506-53595528 CTAAATTTGGAGGTGAGGGCTGG - Intergenic
1117247148 14:53897442-53897464 CAAAATGAGGAGGAGAAGGGAGG + Intergenic
1117675943 14:58154820-58154842 CAAGATGTGGAGGTGAAAGATGG - Intronic
1119003331 14:70903007-70903029 GAGAATTTGGAAGAGAAGGCTGG - Intergenic
1120064089 14:80019430-80019452 GCAGAGGTGGAGGAGAAGGCAGG + Intergenic
1121475705 14:94199960-94199982 CAGAATTTGGACGTGAAGGCAGG + Intronic
1124909751 15:33907461-33907483 AAAAATATGGAACAGAAGGCTGG - Intronic
1126102155 15:45125272-45125294 ATAAAGGTGGTGGAGAAGGCAGG - Intronic
1126814521 15:52441688-52441710 CCAAATGAGGAGAAGAAGTCAGG - Intronic
1128376144 15:67077441-67077463 CAAAAAGTGGAGCAGAGAGCTGG + Intronic
1129182124 15:73884251-73884273 CAAAGTGGGGTGGAGAGGGCTGG + Intronic
1129680454 15:77655854-77655876 AGCAATGGGGAGGAGAAGGCTGG - Intronic
1130933513 15:88449527-88449549 CAAAGAGTGGAGGCAAAGGCAGG - Intergenic
1131178977 15:90227657-90227679 CAAAAGGTGGAGGAGAGAGGTGG + Intronic
1132258460 15:100399899-100399921 CAAAACGTGGAGCAGGAGACAGG + Intergenic
1133855292 16:9544015-9544037 CACAATCTAGAGGGGAAGGCGGG - Intergenic
1134265068 16:12685671-12685693 CAAAATCAGGAGGAAAAGGGAGG - Intronic
1135229639 16:20693715-20693737 CAATAAGTGGAGAAGCAGGCAGG - Intronic
1139144780 16:64310096-64310118 AAAAGTGAGGAGGGGAAGGCAGG + Intergenic
1139718713 16:68835613-68835635 CAAAACGTGGAGAAAGAGGCCGG + Intergenic
1140685077 16:77425744-77425766 CAAAAAGAGGAGGAGTGGGCCGG + Intronic
1141359314 16:83380681-83380703 TAGAATATGGAGGTGAAGGCTGG - Intronic
1141397418 16:83717333-83717355 CAAAAAGTGGGGAAGAAGTCAGG - Intronic
1141473604 16:84256716-84256738 CAAAAAGTGGTGGAGAGGTCGGG + Intergenic
1141553058 16:84819092-84819114 CAAAATGTGGACGGGTATGCAGG - Intergenic
1141920175 16:87130345-87130367 CAAAAAGTAGAGGTGAAGACTGG - Intronic
1141933592 16:87221327-87221349 AAAAATGTGGAGGAAAACACAGG + Intronic
1142106756 16:88308511-88308533 CAGAGTGTGGAGGGGCAGGCTGG - Intergenic
1143095241 17:4475360-4475382 GAAACTGGGGAGGAGATGGCCGG + Intronic
1143194405 17:5064546-5064568 TAAAATTTGGAGGAGGAGGCTGG - Intergenic
1143675491 17:8429536-8429558 CAAAAGGCAGAGGAGAAGGTGGG + Intronic
1144579610 17:16450941-16450963 CAAGAAGTGGGTGAGAAGGCAGG + Intronic
1146112320 17:30101099-30101121 CACACTTTGGAGGACAAGGCAGG - Intronic
1146768500 17:35546446-35546468 CAAGAGGTGGAAGAGCAGGCAGG - Intergenic
1147002392 17:37373173-37373195 CAAAATATCCAGGAGTAGGCCGG - Intronic
1147588974 17:41669079-41669101 CAAAATAGGGAGGTCAAGGCTGG + Intergenic
1148102956 17:45103870-45103892 CAAAATGGTGAGGAGCAGACGGG + Exonic
1148227436 17:45908790-45908812 TTAAATGTGGAGGAGAACGTGGG - Intronic
1150176492 17:63062647-63062669 CAAAATGGGGAGGAGGGGGCTGG - Intronic
1151074408 17:71254656-71254678 CAAAATGAGGAGGAACAGGATGG - Intergenic
1151295554 17:73183622-73183644 CAAAAGGTAGAGCAGAAGACAGG + Intergenic
1152075729 17:78158589-78158611 TAAATTGTGTAGGAGGAGGCCGG - Intronic
1152119975 17:78412624-78412646 CAGAATCTGGTGGGGAAGGCTGG - Intronic
1152255304 17:79235536-79235558 CAAAATGTGCTGGGAAAGGCAGG - Intronic
1152330148 17:79668032-79668054 CATGATGTGGGGGACAAGGCTGG + Intergenic
1153558019 18:6337359-6337381 CAAAATGTTCAGGAGAAGAATGG + Intronic
1154424621 18:14262461-14262483 TAAAGTGTTGAGGAGTAGGCTGG + Intergenic
1154432316 18:14317686-14317708 CAAGTTGGGGAGGAGTAGGCTGG + Intergenic
1155003556 18:21708118-21708140 CAACATGTGAAGGTGGAGGCGGG + Intronic
1155164090 18:23218687-23218709 CAAAATGTGGAGGCCATGGTGGG - Intronic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155853928 18:30808587-30808609 CCAAGCGTGGAGGAGAAGGAAGG - Intergenic
1155940792 18:31800183-31800205 CAGACTGGGGAAGAGAAGGCAGG - Intergenic
1156273117 18:35555564-35555586 CAAAATGTGGAGAAGGATGGAGG + Intergenic
1156551976 18:38027725-38027747 CAACATTTGGACGTGAAGGCAGG + Intergenic
1156661390 18:39350678-39350700 CAAAAAGTGGGGGAGAAGGGAGG - Intergenic
1157306881 18:46524140-46524162 CATGATGTGGTGGTGAAGGCAGG - Intronic
1157439181 18:47697061-47697083 CAGAATGCAGAGGAGAGGGCAGG - Intergenic
1158209537 18:55031879-55031901 CAGAAGGAGGAGGAGAAGGAAGG - Intergenic
1158230195 18:55246148-55246170 TAAATTGTGGAGGAAAAGGCAGG - Intronic
1158571990 18:58604019-58604041 CAGCATGAGGAGGAGAATGCAGG + Intronic
1159559072 18:69975098-69975120 CAGGATGGGGAAGAGAAGGCAGG + Intergenic
1159781925 18:72669780-72669802 TAAATTGAGAAGGAGAAGGCAGG - Intergenic
1161689276 19:5721439-5721461 CAAAATGTGCTGGGTAAGGCTGG - Intronic
1162012820 19:7828652-7828674 CAGAATGGGGAAGGGAAGGCTGG - Intergenic
1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG + Exonic
1164389202 19:27803599-27803621 GAAGATGTGGAAGAGAAGGAAGG - Intergenic
1164697109 19:30253584-30253606 CAAAATGTGGGGCTGGAGGCAGG + Intronic
1165119597 19:33550672-33550694 CAAAAAGAGGAGGTGCAGGCTGG + Intergenic
1165489368 19:36114462-36114484 CAAGATTGGGAGGAGAGGGCAGG + Intronic
1165632347 19:37312502-37312524 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG + Intronic
1166093525 19:40525528-40525550 CAAAACGAGGAGGAGGAGCCCGG + Intronic
1166206175 19:41270888-41270910 TAAAATGGGGAGGAGAGGCCAGG - Intronic
1166500820 19:43339952-43339974 CAAAGGGTGGTGGAGAGGGCTGG - Intergenic
1167104783 19:47423841-47423863 CAGAACGTGGAGGAGATGCCAGG + Intergenic
1167354267 19:48993555-48993577 CAAAGTGGGGAGGAGGAGGAGGG + Exonic
1167431431 19:49457249-49457271 AGAAATATGGAGGAGAAGTCCGG + Intronic
1167909237 19:52688563-52688585 CAAAATGAGGAGCAGAACCCCGG - Intronic
1167958795 19:53089840-53089862 CAAAATGAGGAGCAGAAACCTGG - Intronic
1168073891 19:53968471-53968493 TAAAATGTGAGGGAGATGGCCGG + Intronic
925547692 2:5036398-5036420 CAAACTGTGGGAGAGGAGGCGGG + Intergenic
925578595 2:5386014-5386036 CAAAATGTGGAGGGGCACACAGG + Intergenic
926434137 2:12821485-12821507 CAGGAGGTGGAGGAGAAGGAAGG - Intergenic
926588597 2:14716194-14716216 GGACATGAGGAGGAGAAGGCAGG - Intergenic
927135020 2:20090757-20090779 CGAAGTGTGGAGGAGGAGGAGGG - Intergenic
927601032 2:24441019-24441041 TAAAATGTGGCGGAGAGGCCAGG - Intergenic
928277937 2:29920000-29920022 GAAGATCTGGAAGAGAAGGCGGG + Exonic
928649671 2:33391056-33391078 AAAAAGGTGGAGGGGAAGGAAGG - Intronic
928842056 2:35621104-35621126 CAAAATGTGGGAGAAAAGGTAGG - Intergenic
931420761 2:62124794-62124816 CAAAATTGGGAGGCCAAGGCAGG - Intronic
931665130 2:64605060-64605082 CAAAGTCTGGTGGAGAGGGCGGG - Intergenic
932087370 2:68774347-68774369 CAAGATGTGGAGGTACAGGCTGG + Intronic
933703911 2:85275670-85275692 CAGAATTGGGAGGTGAAGGCGGG + Intronic
933823449 2:86136629-86136651 CCAAATGTGGTGGCTAAGGCTGG - Intronic
934551884 2:95267780-95267802 TAAGAAGTGGGGGAGAAGGCAGG + Intergenic
934672677 2:96225138-96225160 CTATATGTGGAGGAGAATTCTGG - Intergenic
935024317 2:99261628-99261650 CAGACAGTGGAGGAGCAGGCAGG + Intronic
935291002 2:101610968-101610990 CAAAATTTGCAGCAGAAGGCAGG - Intergenic
935870043 2:107438286-107438308 AAGAATTTGAAGGAGAAGGCTGG + Intergenic
936109066 2:109650351-109650373 CAAAAAGTGGAGGTGAAGCCAGG + Intergenic
936542357 2:113362586-113362608 GAAAATATGAAGGAAAAGGCAGG - Intergenic
937585251 2:123539519-123539541 CAAAAGGTGGAAGAGAAGAAGGG - Intergenic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
937785173 2:125887460-125887482 CAGATTGGGGAAGAGAAGGCAGG + Intergenic
938052879 2:128191130-128191152 CAAAATATGTAAGAAAAGGCTGG - Exonic
939554687 2:143660235-143660257 CAGAATGTGGAGGAGGAAGGAGG - Intronic
940040894 2:149359534-149359556 CCAACTGTGAAGCAGAAGGCTGG - Intronic
940075854 2:149741351-149741373 CATAAAATGGAGGAGAATGCTGG - Intergenic
940113258 2:150179098-150179120 GGAAATGTGGAAGAGAAGGCAGG + Intergenic
940385701 2:153068858-153068880 TCAATTGGGGAGGAGAAGGCAGG - Intergenic
941352430 2:164453284-164453306 GAAGATGAGGAGGGGAAGGCAGG - Intergenic
942418442 2:175782826-175782848 TAAAATGTGCAGGAGGAGGCCGG - Intergenic
942447452 2:176087598-176087620 CAGAATGTGAAGGCCAAGGCTGG + Intergenic
942832257 2:180251152-180251174 TAAAAATTGAAGGAGAAGGCTGG + Intergenic
943086180 2:183314181-183314203 CAGAATGTTGAGGAAAAGGGTGG - Intergenic
944861561 2:203819979-203820001 CACAATGGGGTGGAGAAGGCGGG + Intergenic
945680019 2:212902825-212902847 AAAAAGGAGGAGGAGAAGGAAGG - Intergenic
945964596 2:216172713-216172735 CAAAACTTGGAGGCCAAGGCAGG - Intronic
946110466 2:217410791-217410813 GAAAATGTCGTGGAGTAGGCTGG - Intronic
946313557 2:218895961-218895983 GAAAATGTGGAGGTGATGGAGGG + Intronic
946345748 2:219109185-219109207 CAAAATGAGAAGGAAAAGACTGG - Intronic
946945754 2:224820359-224820381 CAAAGTGTGGAGCAGGAGGAAGG + Intronic
947109442 2:226703076-226703098 AAAAATGTTGAGCAGAAGGAGGG + Intergenic
947458847 2:230284371-230284393 CAGAATGAGAATGAGAAGGCAGG + Exonic
948006524 2:234613796-234613818 CAAAAAGTGGAGAAGAAGGCTGG + Intergenic
948030280 2:234812109-234812131 CTAAAAGTGGAAGAGAGGGCAGG - Intergenic
948097889 2:235350854-235350876 CAAAATGTGGGGTGGAAGGCCGG + Intergenic
948258158 2:236583620-236583642 CAAAATGGGGAGGGGGAGGAGGG + Intergenic
948605232 2:239130745-239130767 AGGCATGTGGAGGAGAAGGCTGG - Intronic
1169288040 20:4325973-4325995 CCAAAGGTGGCGGAGGAGGCTGG - Intergenic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1170807186 20:19642510-19642532 TAAAATGTGGAGGAAAATGAAGG + Intronic
1170809721 20:19664484-19664506 CAAAATGAGGATGAGGAGGAAGG - Intronic
1170930510 20:20766021-20766043 CAGAAACTAGAGGAGAAGGCGGG + Intergenic
1171527913 20:25830297-25830319 CAAATTATGGAGGAGGGGGCAGG - Intronic
1171548913 20:26025583-26025605 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1171795065 20:29560167-29560189 CAGGATGGCGAGGAGAAGGCAGG - Intergenic
1171853388 20:30324098-30324120 CAGGATGGTGAGGAGAAGGCAGG + Intergenic
1172610688 20:36249618-36249640 CAAGAGGTGTAGGAGTAGGCAGG - Intronic
1173406582 20:42771502-42771524 CAAAACGTGGAGGTGAATGTGGG - Exonic
1174067766 20:47878170-47878192 CACAAGGCAGAGGAGAAGGCTGG + Intergenic
1174335785 20:49859465-49859487 AAAAAGGTGGAGGGGGAGGCGGG - Intronic
1174853849 20:54023934-54023956 TAAAATGTGAAGTAGAAGACAGG + Intronic
1175453816 20:59094680-59094702 CAAACTGTGGCTGAGCAGGCAGG + Intergenic
1176362063 21:6006180-6006202 CAAAAGGAGGAGGAGGAGGGGGG + Intergenic
1176847465 21:13887629-13887651 TAAAGTGGGGAGGAGTAGGCTGG - Intergenic
1177110450 21:17021141-17021163 CATAATGTGAAGTAGAAGGAGGG - Intergenic
1177430740 21:20989425-20989447 CAAAATGTTTCTGAGAAGGCTGG + Intergenic
1178436489 21:32563789-32563811 GAAAATGTCAAGGAAAAGGCCGG - Intergenic
1178498004 21:33103159-33103181 AAAAAGGTGGAGGTGAAGGTTGG + Intergenic
1178862599 21:36301747-36301769 CAAAAGGTGGAGGAGAACAAAGG + Intergenic
1179761455 21:43532365-43532387 CAAAAGGAGGAGGAGGAGGGGGG - Intronic
1180795826 22:18604679-18604701 AAAAAAGTGGAAAAGAAGGCCGG + Intergenic
1182281664 22:29220920-29220942 CAAGATGTGGAGGTCAAGACAGG + Intronic
1182567695 22:31212372-31212394 GGAAATGGGGAGGAGGAGGCGGG - Intronic
1183037024 22:35148204-35148226 CAATATGTAGAGGAGATTGCGGG - Intergenic
1183285963 22:36964225-36964247 CAGAAGGTGGAGGAGCATGCAGG - Intergenic
1183745773 22:39690970-39690992 GAATCTGTGGAGGAGGAGGCTGG + Intergenic
1184222267 22:43108824-43108846 CAAAAGGAGGAAGAGATGGCTGG - Intergenic
1184793681 22:46718392-46718414 CAAACAGAGGAGGGGAAGGCGGG + Intronic
1184852470 22:47128318-47128340 GAAAATGTGGAGCAGATGGGTGG - Intronic
949607480 3:5670192-5670214 CAAAATTTGGTGAAGTAGGCTGG + Intergenic
949639269 3:6016706-6016728 TAAAATATGGAGGACAAGGCTGG - Intergenic
949747616 3:7312905-7312927 AAAAAAAAGGAGGAGAAGGCAGG - Intronic
950139099 3:10602885-10602907 CCAAAAGTGGAGGAGGAGGGAGG - Intronic
950394729 3:12725404-12725426 CTAAATGTGGATGGGAAAGCAGG - Intergenic
950394827 3:12726062-12726084 CAAAAAGTGGAGGAAAAGGTGGG + Intergenic
950723778 3:14902655-14902677 CAAAATGAGGAGGGGCAGGGAGG - Intronic
951003646 3:17593119-17593141 CAAACTGAGGGAGAGAAGGCAGG - Intronic
951549337 3:23861509-23861531 CAACATTTGGACGTGAAGGCTGG - Intronic
953942171 3:47109660-47109682 AAAAATGTGGAGGGGAAAGATGG + Intronic
954086171 3:48245649-48245671 AAAGATATGGAAGAGAAGGCTGG + Intronic
956063603 3:65373838-65373860 CTAAATGTGGAGGAAAACACTGG - Intronic
956865198 3:73362675-73362697 CAATATGTGGGGGAAGAGGCTGG - Intergenic
957459825 3:80501891-80501913 CTAAATGTGCAGGAGAAAGAAGG - Intergenic
957520457 3:81312229-81312251 AAAAAAGTGGAGGAGAAAACAGG + Intergenic
957857442 3:85895992-85896014 TAAAATGTTGAGGTTAAGGCTGG + Intronic
958603047 3:96323632-96323654 GAAGAGGAGGAGGAGAAGGCGGG + Intergenic
959066296 3:101660523-101660545 CAAAATATGGTGGAGATGGTTGG - Intronic
960601739 3:119465641-119465663 CAAGATGTGGAGGTGAAAGATGG + Intronic
960796809 3:121496145-121496167 CATATTGTTGAGGAGAAGGACGG - Intronic
961574723 3:127824835-127824857 GAAAATTTGGAGGAGAGGCCGGG + Intergenic
963534318 3:146509020-146509042 CAAAAAGTAAAGGAGAAAGCAGG - Intergenic
963896908 3:150696242-150696264 CAAAATTTGGGGGAAAAGGATGG + Intronic
963949782 3:151186447-151186469 CAAGATGAGGTGGAAAAGGCAGG - Intronic
964091738 3:152885242-152885264 CCAAATGTGGAGGCCAAGGAAGG - Intergenic
964138586 3:153371711-153371733 CCAAATTTGGTGGAGAGGGCTGG - Intergenic
964527353 3:157629749-157629771 CAGGGTGTGGAGGAGGAGGCAGG + Intronic
964554153 3:157917428-157917450 CAAAATTTGGAGGGGCAGCCAGG + Intergenic
964667620 3:159191305-159191327 GAAGATGAGGAGGAGGAGGCTGG + Intronic
964692706 3:159469566-159469588 AGAAATGTGCAGGAGCAGGCGGG + Intronic
964868221 3:161285201-161285223 CAAACAGTGGTGGAGAAGGGTGG + Intergenic
964888171 3:161508601-161508623 GCAAGGGTGGAGGAGAAGGCAGG - Intergenic
965152892 3:165005052-165005074 CAGAATGTGAAGGAGAAGCAAGG - Intronic
965513242 3:169592480-169592502 CAGAGGGTAGAGGAGAAGGCTGG - Intronic
965794454 3:172425163-172425185 CAAAATGTGGCAGAGGTGGCGGG - Intergenic
966026214 3:175286288-175286310 AAAAAGGAGGAGGAGGAGGCTGG + Intronic
966209608 3:177439547-177439569 CAAAATGTGCATAATAAGGCTGG - Intergenic
966454547 3:180100457-180100479 CAAAAGGTGGAGGTGATGGGGGG - Intergenic
966525772 3:180917586-180917608 CAAAACGTGGAGGGGAAGGAAGG + Intronic
966564094 3:181356893-181356915 GAAAAAGTGGAGGAGAAAACAGG - Intergenic
967322979 3:188212516-188212538 CCAAATATGGAGAAGCAGGCTGG - Intronic
967324206 3:188222987-188223009 CAACATGTGGAAGAGGTGGCAGG + Intronic
968899564 4:3424788-3424810 ACGAATGTGGTGGAGAAGGCGGG + Intronic
969838267 4:9861008-9861030 CAAAATGAGGAGGAGAATGATGG - Intronic
970124632 4:12795400-12795422 AAAAAGGTGGAGGAGAAGAGAGG + Intergenic
970876797 4:20880341-20880363 AAAAAGGAAGAGGAGAAGGCAGG + Intronic
971135686 4:23865456-23865478 TAAAATGTTTATGAGAAGGCTGG + Intronic
971327362 4:25655473-25655495 CAAGTTCTTGAGGAGAAGGCAGG + Intronic
971478961 4:27097601-27097623 CATCATGTGAAGGTGAAGGCAGG + Intergenic
971786367 4:31108655-31108677 CAAAATGTTTAGAAGATGGCTGG + Intronic
972305532 4:37826646-37826668 CAAGACGTGGAGGCGGAGGCGGG - Exonic
974032009 4:56784557-56784579 TAAAAAGAGGAGGAGAGGGCCGG + Intergenic
974160024 4:58126399-58126421 CAGAATGTTTAGGAGAAGGGAGG + Intergenic
974628773 4:64457106-64457128 CAAAATGTTGATGAGAGGCCTGG + Intergenic
975057673 4:69955095-69955117 CAAAAAGTGGAGGAAAAGAAAGG - Intergenic
975425084 4:74215751-74215773 GAAAAAGGGGAGGAGAGGGCTGG + Intronic
975648591 4:76569459-76569481 CAGAATGAGGAAGAGAAGTCAGG + Intronic
976054069 4:81042673-81042695 CAAAATGTGGGGCAAAGGGCAGG + Intronic
976502498 4:85807768-85807790 CAGGATGTGGAGGAGAATGGTGG - Intronic
976566308 4:86554060-86554082 CAGAAAGGGGAGGAGAAGGCAGG + Intronic
977580042 4:98714842-98714864 CCAAATGTTTAGGAGAAGTCAGG + Intergenic
978270296 4:106881318-106881340 CAAAATGTGGAGGATAAAAATGG - Intergenic
979328216 4:119403384-119403406 GAGAATGTGTAGGAGAAGGACGG - Intergenic
979793919 4:124820088-124820110 TAAAATGTGTAGTAGATGGCCGG - Intergenic
980006329 4:127546543-127546565 CAAACAGTGCAGGAGAGGGCTGG + Intergenic
980494311 4:133571368-133571390 CAAAATTGGGAGGCCAAGGCAGG - Intergenic
981431336 4:144664311-144664333 CAGCATGTGGAGGAGGATGCAGG + Intronic
982130430 4:152224290-152224312 CAAAAGGTGGAGGGGCAGACAGG + Intergenic
982796188 4:159648010-159648032 CAAAATGTAGAGGAGTAATCGGG - Intergenic
983900588 4:173129186-173129208 CAAGATGTGGGGGAGAAGGGTGG + Intergenic
983907742 4:173202449-173202471 CGAAATGGGGAGGAGGAGGAGGG + Intronic
985774394 5:1833287-1833309 CCAAATGTGGTAGAAAAGGCTGG + Intergenic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
987504414 5:18750104-18750126 CAGGATGGGGAAGAGAAGGCAGG - Intergenic
987578313 5:19758043-19758065 CAGACTGGGGAAGAGAAGGCAGG + Intronic
987766381 5:22236823-22236845 CAAGATGTGGAGGTGAAAGGTGG - Intronic
988201392 5:28074560-28074582 GAAAATGTGTAGCAGAGGGCCGG + Intergenic
988251789 5:28768551-28768573 CAATATTTGGAGGCCAAGGCGGG - Intergenic
988461311 5:31440489-31440511 CAAAATGTGGAGGAATAGTAGGG - Intronic
989190707 5:38667247-38667269 CAAAGTGTGGGGGAGATAGCAGG - Intergenic
989426295 5:41299857-41299879 CAAAAGCTGGAGGAGAAGCATGG + Intergenic
989627785 5:43448224-43448246 CAAAATGTGGAGGAGAAGGCAGG - Intronic
990903288 5:60776712-60776734 CAAAATGTGGGAGGGAAGGAAGG + Intronic
990968727 5:61479414-61479436 CAAGATGTGGAGGTGAAGAGAGG - Intronic
992199326 5:74368328-74368350 GAAAAGGAGGAGGAGGAGGCAGG + Intergenic
993505374 5:88702535-88702557 CAAAAGGAGGAGGAGCAGGTTGG - Intergenic
994984386 5:106915465-106915487 CAAGCTGGGGAAGAGAAGGCAGG + Intergenic
995230898 5:109761884-109761906 TAAAATGTTGATAAGAAGGCTGG - Intronic
995784040 5:115809400-115809422 CATAGGGTGGAGGAGAAGGGAGG - Intronic
996046542 5:118880217-118880239 TAAAATGTGGAGGAAAATGTGGG - Intronic
996392173 5:122973517-122973539 CAGGCTGGGGAGGAGAAGGCTGG + Intronic
996856175 5:128009872-128009894 AGAAATGTGGAGGAAGAGGCTGG - Intergenic
997193553 5:131962430-131962452 TAAAATGCGGAGGAGAATCCTGG + Intronic
997348529 5:133211733-133211755 CAGAATGAAGAGGAGAAGCCAGG - Intronic
998376594 5:141694901-141694923 GAAAGTGTGAAGGAGAAGGAGGG + Intergenic
998647135 5:144074803-144074825 CAAAAGGTGAAGGAGAAGCAAGG - Intergenic
999539035 5:152551463-152551485 CAGAATGTGGGGCTGAAGGCAGG + Intergenic
999921087 5:156321846-156321868 CAAGAAGTGGATGTGAAGGCAGG - Intronic
1001429207 5:171646197-171646219 TATAATGTGGAGGAGAGGGGAGG + Intergenic
1003172076 6:3727743-3727765 CAACAGGTGGAGGAGAAAGCAGG - Intronic
1003904277 6:10684662-10684684 GAAAATGTAAAGGAGAGGGCTGG + Intronic
1005826194 6:29632926-29632948 AGAAAGGTGGAGGAGAAGGGAGG - Exonic
1005907027 6:30271153-30271175 CAAAACTTGGAGAAGAAAGCAGG + Intergenic
1006574131 6:35031530-35031552 CAAAATGGGGAGGAGGAGGAAGG - Intronic
1006817498 6:36862350-36862372 CAGGCTGTGGAGGAGGAGGCTGG - Intronic
1006877871 6:37314347-37314369 CATAACGTGAAGGACAAGGCCGG - Intronic
1007220351 6:40274110-40274132 GAAAATGAGGAAGAGAGGGCTGG + Intergenic
1007400030 6:41598161-41598183 GAAAATGGGGAGGAGAAGGTGGG - Intronic
1008124565 6:47653983-47654005 CAAGATGAGCAGGACAAGGCAGG + Intergenic
1008261210 6:49368408-49368430 CAAAATGTGGAGGGTGGGGCCGG + Intergenic
1008673971 6:53799850-53799872 CAAAATGGAGAGAAGAAGGAAGG - Intronic
1009582613 6:65556362-65556384 TAATATGTGGAGGAGACTGCTGG + Intronic
1010107972 6:72190644-72190666 CATGCTGTGGGGGAGAAGGCAGG + Intronic
1010706049 6:79112109-79112131 TAAGATGTGAAGGAGAAGTCAGG - Intergenic
1010788530 6:80034621-80034643 CAAAATGTTAAGGACAAGCCTGG - Intronic
1010851981 6:80788321-80788343 CAAGATATGGAAGAGAAGGACGG + Intergenic
1011220259 6:85047689-85047711 CAAAATGTGGAAGAGAATTTGGG + Intergenic
1012735580 6:102937083-102937105 CAAAATGTGGGTGAGAATGTGGG - Intergenic
1012949504 6:105503119-105503141 CTCAATGTGGGGGAGATGGCAGG + Intergenic
1014448633 6:121558208-121558230 CAAAAATGGGAGGATAAGGCGGG - Intergenic
1015139198 6:129910520-129910542 CAAAATATGGTGGAGAAAGGTGG - Intergenic
1015333223 6:132005589-132005611 AAGAAGGTGGAGGAGCAGGCAGG + Intergenic
1015850691 6:137568795-137568817 GAAAAGGAGGAGGAGAAGGAGGG + Intergenic
1016073084 6:139764047-139764069 TGAACTGTGGAGGAGTAGGCTGG - Intergenic
1016147297 6:140692447-140692469 CAGGCTGTGGGGGAGAAGGCAGG + Intergenic
1016831726 6:148440810-148440832 CAAAATGAGGTGCAGAAGACGGG - Intronic
1017473667 6:154766239-154766261 AAAGATGTGGAGGAGAGGGAAGG + Intronic
1018023740 6:159788643-159788665 CAGAATCTGAAGGAAAAGGCTGG - Intronic
1019032869 6:169027739-169027761 CAGAAGGAGGAAGAGAAGGCGGG + Intergenic
1019693936 7:2434057-2434079 CGAAATGTGGAAGGGAATGCTGG + Exonic
1020253061 7:6484454-6484476 GAAAAAGTGTAAGAGAAGGCCGG + Intergenic
1020255842 7:6502869-6502891 CAAACTGTGGACAAGAAGGTGGG + Exonic
1020755911 7:12202833-12202855 CAAAATCTGAAGGGGGAGGCTGG - Intergenic
1020823033 7:12994253-12994275 CATAATGGGGAGGAGAAAGAAGG - Intergenic
1021928376 7:25554854-25554876 TAAGATGTGGAGAGGAAGGCAGG + Intergenic
1022044312 7:26611078-26611100 CACAATGAGGAGGAGAAGAGGGG - Intergenic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023047562 7:36223987-36224009 GAAAATTTGGAAGAAAAGGCAGG - Intronic
1024539288 7:50463062-50463084 TAAAATAAGGAAGAGAAGGCCGG - Intronic
1025297730 7:57789586-57789608 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1026605218 7:71810134-71810156 CAGAATTTGGAGGAGAAAGATGG + Intronic
1028621944 7:92835459-92835481 AAAAAAGTGGAGGAGAGGGGGGG - Intronic
1029174377 7:98653766-98653788 GAAAAGGAGGAGGAGAAAGCAGG + Intergenic
1029462056 7:100700717-100700739 CCAAGTGTGGATGAGAATGCAGG - Intergenic
1033034144 7:137856057-137856079 CAAGGTGTGGAGGACAAAGCTGG + Intergenic
1034040998 7:147876614-147876636 AAAAATGTGGAGGGAAAGGAAGG - Intronic
1034055900 7:148034717-148034739 GAAAATTTGGAGGAGTAGGCTGG + Intronic
1034994498 7:155569679-155569701 CAGGGTGTGGAGGGGAAGGCAGG - Intergenic
1036557852 8:9875794-9875816 CAAAATGAGGAAGAGGTGGCTGG + Intergenic
1037465835 8:19159295-19159317 CAAAATGTGGAGGATTTAGCAGG + Intergenic
1037583763 8:20262318-20262340 CAAAATGTAGAGGATCAGGTGGG + Intronic
1037692050 8:21190125-21190147 CCAAATGTAGAGTAGAAGACAGG - Intergenic
1037926951 8:22851153-22851175 CCAAATGTGGAGGAGAGGAAAGG - Intronic
1038736524 8:30174580-30174602 AGAAATGTGGAGGCCAAGGCGGG - Intronic
1040890848 8:52314588-52314610 CAAAACGGAGAGGAGAAAGCTGG - Intronic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041328554 8:56697299-56697321 GAAAAGGAGGAGGAGAAGGAGGG - Intergenic
1041709560 8:60881498-60881520 CAGAAGTCGGAGGAGAAGGCAGG - Intergenic
1041766078 8:61419602-61419624 CAAAAGGTAAAGGAGAAGCCTGG - Intronic
1045451042 8:102325996-102326018 GAAAGGGTTGAGGAGAAGGCAGG + Intronic
1046815553 8:118579623-118579645 CATTATTTGGAGGAGAAGGGAGG + Intronic
1047006077 8:120621817-120621839 CAAAACGTGGAGGAGATCTCTGG - Intronic
1048007633 8:130432012-130432034 GAAAATGGGGAGGAGAAGGAGGG + Intronic
1049188489 8:141272399-141272421 ACAGATGTGGAGGAGAAGGTGGG - Intronic
1049611009 8:143555326-143555348 CAGAATGTGGCGGTGAAGGGTGG + Intronic
1049953096 9:664541-664563 GAAAATGTGGAGGCCAAGGCAGG - Intronic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1050192611 9:3044077-3044099 CAAAGGATGGAGGAGAAGGCAGG - Intergenic
1051133699 9:13893352-13893374 AAAAATGTGGAGGAGAGGAAGGG - Intergenic
1051727251 9:20101037-20101059 AAAGATGTGGGGGTGAAGGCAGG - Intergenic
1052043698 9:23770246-23770268 GAAAATGTGGAGATGAAGACGGG + Intronic
1053088583 9:35251258-35251280 CAAAAAATGGAAGAGTAGGCCGG - Intronic
1053791190 9:41687397-41687419 CAGGATGGTGAGGAGAAGGCAGG + Intergenic
1053795877 9:41726445-41726467 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1054149302 9:61588428-61588450 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054153963 9:61627375-61627397 CAGGATGATGAGGAGAAGGCAGG - Intergenic
1054179538 9:61899091-61899113 CAGGATGGTGAGGAGAAGGCAGG + Intergenic
1054184284 9:61938516-61938538 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1054469064 9:65519539-65519561 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054654222 9:67649979-67650001 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054658000 9:67681730-67681752 CAGGATGGTGAGGAGAAGGCAGG - Intergenic
1055605938 9:77970466-77970488 CAAAATCTGGGGTTGAAGGCAGG + Intronic
1056178354 9:84057683-84057705 CAAAATGAAGGGGAAAAGGCAGG + Intergenic
1056435797 9:86575092-86575114 CAAAATCAGTTGGAGAAGGCTGG - Intergenic
1056812648 9:89776425-89776447 CACAATGTGCAGGAAAGGGCTGG + Intergenic
1057455501 9:95206154-95206176 GAAAATTTAGAGGAGGAGGCGGG + Intronic
1057677873 9:97149908-97149930 CAGGGTGGGGAGGAGAAGGCTGG - Intergenic
1057745634 9:97748732-97748754 GACAAAGTGGAGCAGAAGGCAGG + Intergenic
1058209007 9:102143963-102143985 GTAAATGTGGAGGAGAAAACTGG + Intergenic
1059220693 9:112615123-112615145 AAAAATGAAGAGGAGGAGGCCGG + Intronic
1059679467 9:116572195-116572217 CAGCCTGGGGAGGAGAAGGCAGG - Intronic
1059754667 9:117281626-117281648 GAAAATGTGGAACAGGAGGCTGG + Intronic
1060056119 9:120414545-120414567 AAAAAAGTGGAGAAGAAGGAAGG + Intronic
1060163232 9:121386436-121386458 CAAGATGGGGAGGGGAAGGAGGG + Intergenic
1060239627 9:121891560-121891582 CAAAATGTGATGGATAAGACAGG - Intronic
1060483144 9:124029822-124029844 CAGATTGGGGTGGAGAAGGCCGG - Intronic
1060569605 9:124626300-124626322 CAAAATCTGTAGGATATGGCTGG - Intronic
1061266448 9:129508101-129508123 GAAAAAGGTGAGGAGAAGGCCGG + Intergenic
1061293234 9:129664262-129664284 CAAAATGAGGCCGAGTAGGCCGG - Intergenic
1061709016 9:132474699-132474721 CCAAAGGTTGAGAAGAAGGCAGG + Intronic
1186656164 X:11614205-11614227 CAACACTTGGGGGAGAAGGCTGG - Intronic
1187101427 X:16196895-16196917 TACAATGTTGAGGAGAAGGTGGG - Intergenic
1187384986 X:18840163-18840185 CAAATTCTGGAGGATAAGGTAGG - Intergenic
1187505436 X:19874972-19874994 GAAAAAGAGGGGGAGAAGGCAGG + Intronic
1188010438 X:25049544-25049566 AAAAATGTGGAGGAAAACCCCGG + Intergenic
1188989203 X:36796770-36796792 CTAAATGTGGATGAGAATGTGGG - Intergenic
1189191904 X:39116768-39116790 CAAAATGACGAGGTGAAGGCAGG - Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190830326 X:54053595-54053617 CAAAAAGCAGAGGAGAAAGCCGG - Intergenic
1193041393 X:77007389-77007411 CAAAATGTGGAGGGAAGGGAGGG + Intergenic
1193248451 X:79259133-79259155 CACAAAGTGGAGGAGGAGGATGG + Intergenic
1194284079 X:91988293-91988315 CAGTATGAGGAGGAGAAGGGAGG - Intronic
1196278810 X:113799027-113799049 CAAAATGTGTAGGACCAGGGAGG - Intergenic
1196495217 X:116317021-116317043 CAAAGTGTGAAGGAGAAAGTGGG + Intergenic
1197326485 X:125100764-125100786 CAAAATCAGGAGGAGAAGGAGGG - Intergenic
1197461110 X:126742498-126742520 CAAAATGCGCATGAGGAGGCTGG - Intergenic
1197828608 X:130616837-130616859 CATAATGCAGAGGAGAAGTCAGG + Intergenic
1197995325 X:132366594-132366616 AAAAACTTGGGGGAGAAGGCCGG - Intergenic
1198150595 X:133904647-133904669 TAAAATGTTGATGAGAAGGCAGG + Intronic
1199083492 X:143604100-143604122 CAAAATGGTGAGGAGGAGCCTGG - Intergenic
1199257994 X:145739052-145739074 CAGAAGGTGAAGGAGAAGGCAGG - Intergenic
1200814610 Y:7518463-7518485 CAGAATGTGCAGGAGAAGCATGG + Intergenic
1200908948 Y:8514282-8514304 CAGTAGGTGGAGGAGAAAGCTGG - Intergenic
1202598413 Y:26568014-26568036 CACATAGTGGAAGAGAAGGCTGG - Intergenic