ID: 989635614

View in Genome Browser
Species Human (GRCh38)
Location 5:43529797-43529819
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 2, 1: 0, 2: 2, 3: 25, 4: 369}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989635614_989635616 -10 Left 989635614 5:43529797-43529819 CCCGGATAAATCTGTTCCATTTT 0: 2
1: 0
2: 2
3: 25
4: 369
Right 989635616 5:43529810-43529832 GTTCCATTTTCTTCATAATCTGG 0: 2
1: 0
2: 1
3: 20
4: 307
989635614_989635619 21 Left 989635614 5:43529797-43529819 CCCGGATAAATCTGTTCCATTTT 0: 2
1: 0
2: 2
3: 25
4: 369
Right 989635619 5:43529841-43529863 CCTCTCTTTCAAGTAATTCTTGG 0: 2
1: 0
2: 0
3: 14
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989635614 Original CRISPR AAAATGGAACAGATTTATCC GGG (reversed) Exonic
903142572 1:21347787-21347809 AAAATGAAACCCAGTTATCCTGG + Intergenic
903194311 1:21673451-21673473 AAAGGGGAACAGACTTGTCCAGG + Intergenic
903213364 1:21830527-21830549 AAAATGCAAAAAATTTAGCCAGG + Intronic
903828152 1:26159701-26159723 ACAAAGGAACAGAATTAGCCAGG - Intronic
905117009 1:35650876-35650898 AAAATGGAAGTGATATATCTTGG + Intergenic
905292513 1:36932055-36932077 ACAATAGAACAAGTTTATCCAGG - Intronic
905840155 1:41169802-41169824 AAAAAGCAGCAGATTTATACGGG - Intronic
906711981 1:47937554-47937576 AAAATGGAAGAGGTTTGTTCAGG + Intronic
906993457 1:50764223-50764245 AATATGGAAAATATTTATTCTGG + Intronic
909006004 1:70277295-70277317 AAAATGCAAAAGAATTATCCGGG + Intronic
909068478 1:70963748-70963770 AAAATGGAAAAAATGTCTCCAGG - Intronic
909618191 1:77636552-77636574 AAAATACAAAAAATTTATCCAGG + Intronic
910350402 1:86290180-86290202 AAAATAAAACAGTTTTATTCAGG + Intergenic
911132931 1:94408993-94409015 AAAAAGGAACAGATTGATAAGGG - Intergenic
911229872 1:95349621-95349643 AAAATAGAAAAGATCTATGCAGG + Intergenic
911329801 1:96513852-96513874 ATAATGCGACAGAGTTATCCAGG - Intergenic
911605725 1:99902811-99902833 AAAATAGTACAAATTTATCAAGG + Intronic
912063459 1:105704323-105704345 AACATGGTTCAGATTTATACTGG - Intergenic
912222719 1:107696832-107696854 AAAAGGGATAAGATATATCCAGG - Intronic
913079118 1:115365307-115365329 AAAAATGAACAGATTTATTCAGG + Intergenic
915338858 1:155165423-155165445 AAAATGCAACAAAATTAGCCAGG + Intergenic
916294015 1:163197044-163197066 AGGATGGAAGAGATTTATTCAGG - Intronic
916696900 1:167247234-167247256 AAAATAAAACAAAATTATCCAGG - Intronic
917680120 1:177357016-177357038 AAAATGGAACAGAATTTACAAGG + Intergenic
918306331 1:183250195-183250217 AAGATGGAACAGCCTTGTCCAGG - Exonic
918550001 1:185731812-185731834 AAAATGTAGCATATTTACCCAGG - Intergenic
918733169 1:188023321-188023343 TGAGTGGTACAGATTTATCCTGG - Intergenic
918841520 1:189546540-189546562 AAAATGGAACATAGCTAACCGGG + Intergenic
919557880 1:199083542-199083564 AATATGAAACCTATTTATCCTGG + Intergenic
921490185 1:215765995-215766017 AAAATAGAACAGCTGTATCATGG + Intronic
921512048 1:216043892-216043914 AAAATGGAAAAGATACAGCCAGG - Intronic
922662387 1:227441429-227441451 AAAATTTAAAATATTTATCCTGG + Intergenic
922928373 1:229369587-229369609 AAACTGGACCAGTATTATCCTGG - Intergenic
923157020 1:231288254-231288276 AAAATGGAAATAATTTATACAGG + Intergenic
923364861 1:233249229-233249251 AAAATGACATATATTTATCCTGG + Intronic
924279259 1:242419554-242419576 AAAATGCAAAAAATTTAGCCGGG - Intronic
1063343444 10:5290249-5290271 AAAATGCAAAAAATTTAGCCGGG - Intergenic
1063779259 10:9302770-9302792 AAAATGTAATAGAAATATCCTGG - Intergenic
1064405832 10:15061830-15061852 AAAATGCAAATGGTTTATCCTGG - Exonic
1065745893 10:28841748-28841770 AAAATAGAAATGATTCATCCTGG - Intergenic
1067182481 10:43999446-43999468 AAAGTGGAAGATATTTATTCAGG - Intergenic
1068295478 10:55066219-55066241 AAAATCACACACATTTATCCTGG - Intronic
1068594587 10:58888953-58888975 AAAATGGGACAAATTTACTCAGG - Intergenic
1069509630 10:69032226-69032248 AAAAGTGAACAGAATTAGCCAGG - Intergenic
1071226755 10:83539374-83539396 AAAAGGGAGCAGCTATATCCTGG - Intergenic
1072841197 10:98775850-98775872 AAAAAGAAACAGATTTATTGGGG - Intronic
1074095485 10:110308200-110308222 TACATGGAACACATATATCCTGG + Intergenic
1074581408 10:114722801-114722823 AAAAGGGAAAAGAACTATCCAGG - Intergenic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079860772 11:25668711-25668733 AGAGTAGAACAGATTTAACCAGG + Intergenic
1079994688 11:27283077-27283099 AACATGGAGCAAATTTCTCCTGG - Intergenic
1081503719 11:43693248-43693270 AAAGTGGAAGAGATTTGTCTGGG + Intronic
1081817872 11:45962253-45962275 AAAAGGGAACCTATTTAGCCTGG + Intronic
1082619402 11:55401349-55401371 AAAATGGAACATATTTAAATGGG - Intergenic
1082858358 11:57829560-57829582 AAAATGGCACAGACTTATAATGG - Intergenic
1083696293 11:64444918-64444940 AAAATGAACCAGATTTAGCCAGG - Intergenic
1084233332 11:67769223-67769245 AAAATGGAAATGGTTTATACTGG + Intergenic
1088007044 11:104954145-104954167 AAAATGCAACAGTTTTGTTCTGG + Intronic
1088015912 11:105059841-105059863 AAAGTGGAACAGGTTTGTTCTGG + Intronic
1088616259 11:111632094-111632116 AAAAAGGAACAGAAATATGCAGG + Intronic
1088977536 11:114829259-114829281 AAAATGGCACAGATATTGCCAGG + Intergenic
1089463054 11:118664044-118664066 AAAATGGAAATGGTTTATTCAGG + Intronic
1091099372 11:132856254-132856276 AAATGGGAACTGATTTAACCTGG + Intronic
1091599515 12:1909350-1909372 AAAATGCAAAAAATTTAGCCGGG - Intronic
1096524869 12:52204483-52204505 AAAATGGAACAGATAATTGCTGG + Intergenic
1096663475 12:53145450-53145472 AATATGTAAGAGATTTATCACGG + Intergenic
1097473955 12:60030927-60030949 AAAATAGAACAAATCTATGCAGG - Intergenic
1098184084 12:67878144-67878166 AAAATGGAGATGATTTATACAGG + Intergenic
1098593370 12:72240888-72240910 AAAAATAAACAAATTTATCCGGG + Intronic
1099237711 12:80101901-80101923 GAAATGGAACAGATTAATATTGG - Intergenic
1099741107 12:86635582-86635604 AAAATGGACCAGATATACCATGG + Intronic
1099842467 12:87983102-87983124 AAAAGTGAAAAGATATATCCAGG - Exonic
1099932802 12:89092760-89092782 AAAATTGAAAACATATATCCAGG + Intergenic
1101183150 12:102241960-102241982 AAAATGGAACAAATGGATGCAGG - Intergenic
1101744120 12:107525164-107525186 AAAATGAAACAAAATTAGCCAGG + Intronic
1102171471 12:110845925-110845947 AAAATATAACAAATTTAGCCCGG - Intergenic
1103140998 12:118548212-118548234 AGAAAGGAAAAGATTTATCGTGG + Intergenic
1103720529 12:122972669-122972691 AAAATATAACAAAATTATCCAGG - Intronic
1103798468 12:123521447-123521469 AAAAAGGAAAAGTTTGATCCAGG - Intronic
1104459386 12:128942519-128942541 AAAATGGAAAAGATTTTTAAAGG + Intronic
1105343974 13:19556684-19556706 AAAATAGAAAAAAATTATCCAGG - Intergenic
1105536064 13:21264905-21264927 AAAATAGAAAAAAATTATCCGGG + Intergenic
1106234057 13:27846509-27846531 AAAATGCAAAAGAGTTAGCCAGG + Intergenic
1106655580 13:31742749-31742771 AAAATGGCACATTTTTATTCTGG + Intronic
1107477473 13:40752897-40752919 AAAATAGAAAAAAATTATCCAGG - Intronic
1107531126 13:41283250-41283272 AAAATGGAAATGGTTTATACAGG - Intergenic
1107557621 13:41531428-41531450 AAAATGGAAGAGATTTCCTCTGG + Intergenic
1108966052 13:56303358-56303380 AACATTGAATAGATTTACCCAGG + Intergenic
1110618503 13:77568764-77568786 TAAATGGAACACATTTTCCCTGG + Intronic
1111154727 13:84307872-84307894 AAAATGCAAAAAATTTAGCCGGG + Intergenic
1111237057 13:85423046-85423068 AGAATGGAACTGATTTCTTCTGG - Intergenic
1112561150 13:100515459-100515481 AGAATTGAACAAATTTATGCTGG + Exonic
1112784282 13:102934718-102934740 AAAATGCAACAAAATTAGCCTGG + Intergenic
1113283572 13:108818861-108818883 AAAATGGAGCAGGCTTCTCCTGG - Intronic
1113398573 13:109971323-109971345 AAAATCTAACAGATTTAATCAGG + Intergenic
1113902923 13:113806533-113806555 GAAATGGAAAAGATGTTTCCAGG - Intronic
1114942566 14:27632650-27632672 AAAATAGATCAAATCTATCCTGG + Intergenic
1115546739 14:34471038-34471060 AAAATGGAACAGAATCATCCAGG + Intergenic
1115603866 14:34981314-34981336 AAAATGGGATAGATGTATTCTGG - Intergenic
1116261480 14:42633957-42633979 AAATTGCAACAAATTTAACCAGG + Intergenic
1116611290 14:47075469-47075491 AAAATGGAACAAATTTGTTCAGG - Intronic
1116767508 14:49090759-49090781 ATAATGGAACATATATACCCTGG + Intergenic
1118694601 14:68371960-68371982 AATATGGCAGAGATTGATCCTGG + Intronic
1119856705 14:77906442-77906464 AAAAGAGAACAGATTTCTCCAGG - Intronic
1120419416 14:84264390-84264412 AAAATGGAGAAAATTTATCATGG + Intergenic
1121213049 14:92223643-92223665 AAAATGCAAGAGTTTTACCCAGG + Intergenic
1121359283 14:93241558-93241580 GAAATGTAACAGCTTTAGCCTGG + Exonic
1121991903 14:98566205-98566227 AAAATGAAAAAGCATTATCCTGG - Intergenic
1122100429 14:99404880-99404902 TAAATGAAACAAATTGATCCAGG + Intronic
1122109100 14:99482667-99482689 AAAATGGAACAAATTTAAACAGG - Intronic
1123720716 15:23059446-23059468 AAAATGCAAAAAAATTATCCAGG + Intergenic
1124089369 15:26583591-26583613 AATATAGACCAGATTTATCAAGG + Intronic
1125580033 15:40778773-40778795 AAAACGGAACAAAATTAGCCGGG + Intronic
1126815541 15:52449838-52449860 AAAAATGAACAGAATTAGCCAGG + Intronic
1131677084 15:94681762-94681784 AGAAAGGAACAGATTTACCAGGG + Intergenic
1132026667 15:98409419-98409441 ACAATGGTACAGATATGTCCAGG - Intergenic
1134357637 16:13499064-13499086 AGAAGTGTACAGATTTATCCAGG - Intergenic
1135603032 16:23799539-23799561 CTAATGGAAAAGATTTATTCAGG - Intergenic
1136374381 16:29856722-29856744 AAATTGGAACAGATCTAGGCCGG - Intergenic
1137508406 16:49076706-49076728 AAAATAGAAGAGATGTTTCCAGG + Intergenic
1137831623 16:51549097-51549119 AAAAAGGAAAAAAATTATCCGGG - Intergenic
1138062135 16:53902947-53902969 AAAATGCAAAAGACTTAGCCAGG + Intronic
1138170453 16:54844452-54844474 AAACTGGAACATAATTACCCTGG + Intergenic
1139074156 16:63423018-63423040 TAAATGGAGCAGATTTATAAGGG + Intergenic
1139287575 16:65829348-65829370 AAGATGAGACAGATTTTTCCAGG - Intergenic
1139417498 16:66825688-66825710 TAACTGTAACAGATTTATTCAGG + Intronic
1139747213 16:69084185-69084207 AAAATGGAATAAAGTTATCTTGG + Exonic
1141492362 16:84382733-84382755 AAAATGCAAAACATTTAGCCAGG + Intronic
1142169989 16:88616747-88616769 AAAATGACACAGTTTTACCCAGG + Intronic
1143452758 17:7045595-7045617 AAAAATGAACAAATTTAGCCAGG - Intergenic
1144255828 17:13466081-13466103 GAAATGGAATAGATTCATCAGGG + Intergenic
1144503051 17:15806243-15806265 AAAATAAAAAAAATTTATCCTGG - Intergenic
1144907874 17:18651415-18651437 AAAATGGAACAGATTTATCCGGG + Intronic
1147655966 17:42091277-42091299 AAAATGTAACAAAATTATCCAGG + Intergenic
1149143510 17:53461982-53462004 AAAATAAAAGAAATTTATCCAGG + Intergenic
1149353189 17:55812742-55812764 TAAATGACACAGATTTAGCCTGG - Intronic
1149907510 17:60539683-60539705 ACAATGGAACAGATTTACTTGGG + Intergenic
1150753208 17:67885423-67885445 AAAATATAAAAGAATTATCCAGG + Intronic
1150831425 17:68523337-68523359 AAAGGGGAACAGAATTGTCCTGG + Intronic
1152219822 17:79057307-79057329 AAAATAGAAAAAATTTAGCCAGG + Intergenic
1156118468 18:33815897-33815919 AAAATGGTACATATGTAACCAGG + Intergenic
1156222769 18:35070301-35070323 AAAGTGGAACAGCTTTGTTCAGG + Exonic
1156947000 18:42845181-42845203 AAAATGGAAGAGATTTTTCAGGG + Intronic
1157165008 18:45350746-45350768 CACAAGGAAAAGATTTATCCAGG + Intronic
1157352869 18:46905978-46906000 AAAAAGGAACAGATAGATCAGGG + Intronic
1158301630 18:56058959-56058981 AAAATAAAACAGAATTATCCTGG - Intergenic
1158722080 18:59934141-59934163 AAAATTAAATAGATTTATTCTGG + Intergenic
1164677735 19:30112970-30112992 AAAATAGAAAAAAATTATCCAGG + Intergenic
1166513866 19:43430929-43430951 AAAATGGAAAAAATGTTTCCTGG + Intergenic
1167303305 19:48692397-48692419 AAAGTGGAACTCATTTATACAGG - Intergenic
1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG + Exonic
1167757873 19:51424331-51424353 AAAATAGAAAAGAATTAGCCGGG + Intergenic
1167989048 19:53342273-53342295 AAAATGCAACTAAATTATCCGGG - Intronic
1168656824 19:58135610-58135632 AGAATGGAAAAGAGTTATGCAGG + Intronic
927830307 2:26344670-26344692 AAAATGCAAAAAATTTAGCCGGG + Intronic
928695997 2:33850918-33850940 AAAATGGAAATGATTTATATGGG + Intergenic
929241790 2:39660961-39660983 AAAAGGAAACAGCTTAATCCAGG + Intergenic
929518570 2:42626696-42626718 AAAATGGAACTGACCTATCCAGG - Intronic
929570104 2:43017446-43017468 AAAATGCAAAAAAGTTATCCGGG - Intergenic
930240506 2:48931517-48931539 AAAAATGAAGAGATTTACCCAGG + Intergenic
930678114 2:54226279-54226301 AAGATGGTCCAGACTTATCCAGG - Intronic
930827801 2:55711874-55711896 AAAATGCAAAAAATTTAGCCAGG - Intergenic
931347641 2:61461230-61461252 AAAATGCAAAAGAATTAGCCAGG + Intronic
931424083 2:62154932-62154954 GGAATGGAACAGATTCTTCCTGG - Intergenic
931473884 2:62568661-62568683 AAAATGGAAGAGATTCATATAGG + Intergenic
932877356 2:75466991-75467013 GAAATACAACAGAATTATCCAGG + Intergenic
934226198 2:90133267-90133289 AAAATGGAATAGCTTTCTACGGG + Intergenic
936246258 2:110830415-110830437 AAAATGCAATAGATTTATTGTGG - Intronic
937020608 2:118648909-118648931 AAAATGGAAAAGATTTACCAGGG - Intergenic
937337941 2:121073119-121073141 AAAGTGGAACACAGTGATCCTGG - Intergenic
938740633 2:134228438-134228460 AAAATGTCAGATATTTATCCGGG - Intronic
939176615 2:138756233-138756255 AAAATGAAAAAGATTTATATTGG - Intronic
940496722 2:154438520-154438542 ACAATAGAGCAGATCTATCCAGG - Intronic
941079978 2:161049443-161049465 AAAAAGGAACAAATGTATGCTGG - Intergenic
941425394 2:165338418-165338440 AAAATGCAACAAAATTAGCCAGG - Intronic
941981664 2:171465035-171465057 AAAATAGAAAAAATTTAGCCAGG + Intronic
942078178 2:172376307-172376329 AAAATTGAAGAAATCTATCCTGG - Intergenic
942583431 2:177446762-177446784 AAAATGGAACAGTTTGAACATGG + Intronic
943068515 2:183114221-183114243 AAAATGGAAAAGTTTTAAGCAGG + Intergenic
944115075 2:196177148-196177170 AAAAAGGAAGAGATTTATTAGGG - Intergenic
944686527 2:202122660-202122682 AAAATACAACAAATTTAGCCAGG - Intronic
945474429 2:210264470-210264492 AAAATGGAAGAGAGTTGTCAGGG - Intergenic
945690348 2:213026255-213026277 AAAATGGAACAGAGTTAAGGAGG - Intronic
946753985 2:222924549-222924571 AAAATGGAACAGATTTCAAAAGG + Exonic
1168870746 20:1126076-1126098 AAAATGAAAGAGAATTGTCCAGG - Intronic
1169645460 20:7804414-7804436 AAAAAGGAAAAGATTTTTACAGG + Intergenic
1169728736 20:8764004-8764026 AAAATAGAAAATAATTATCCGGG + Intronic
1169924311 20:10766819-10766841 AAATAGGAACAGATGAATCCAGG + Intergenic
1172341715 20:34163070-34163092 AAAATGCAACAAAATTAGCCGGG - Intergenic
1173796574 20:45865008-45865030 AAAATACAAAAAATTTATCCAGG + Intronic
1174003019 20:47388580-47388602 AAAATTCAACATTTTTATCCAGG + Intergenic
1174860874 20:54089792-54089814 AAAATGGAACAAACTTATTGAGG - Intergenic
1175342466 20:58242356-58242378 AAAAAAGAACAGATTCCTCCAGG - Intergenic
1175632323 20:60551856-60551878 AATATGGCACAGATCAATCCAGG + Intergenic
1177465525 21:21474240-21474262 AAAATGTAATTGATTTATGCTGG + Intronic
1177558342 21:22719048-22719070 AAAATGGAAATGATTTATAAAGG + Intergenic
1177688260 21:24468511-24468533 AAAATGGATTATATTTATCAGGG + Intergenic
1178529647 21:33364968-33364990 AAAAATGAACAGAATTAGCCAGG + Intergenic
1181593641 22:23899343-23899365 ACTATGGAACAGATTAACCCCGG + Intergenic
1181733322 22:24863315-24863337 AAAATAGAAAAGAATTAGCCAGG - Intronic
1182988035 22:34739585-34739607 CCAATGGATCAGATCTATCCTGG - Intergenic
1183003634 22:34881793-34881815 GCAATGAAACAGATTCATCCAGG - Intergenic
1183830050 22:40413600-40413622 AAAATACAAAAAATTTATCCGGG - Intronic
949297515 3:2543065-2543087 TAAATGGTAAAGATTTATCTTGG - Intronic
951202591 3:19891556-19891578 AAAATATAACAGGTTTATCAAGG - Intronic
952072215 3:29650986-29651008 AAAATAGTTGAGATTTATCCAGG - Intronic
952704766 3:36366105-36366127 AAAATGGAAATGATTTATATAGG + Intergenic
953156128 3:40375826-40375848 AAAATGAAACAGAATTACACAGG - Intergenic
953309744 3:41864913-41864935 CTAATGGAAAAGATTAATCCTGG - Intronic
953706217 3:45232778-45232800 ACATTGGAACACATTTATCATGG + Intergenic
953765062 3:45733620-45733642 AAAATGCAACAGATTCATCAAGG - Intronic
954028070 3:47798854-47798876 AAAATTGAAAAAATTTATCCAGG - Intergenic
954113816 3:48452532-48452554 AAAAATGAACAAAATTATCCAGG + Intronic
954123521 3:48514945-48514967 AAAACAGCACAGATTCATCCTGG + Intergenic
954334782 3:49909856-49909878 AAACTGGAACAGAGGTCTCCGGG - Intronic
954469524 3:50680370-50680392 AAAATAGAAAAGAATTAGCCAGG - Intronic
954964286 3:54596824-54596846 AAAATGGGAAAGAGTTAACCAGG - Intronic
955161251 3:56467690-56467712 AAAATGAAGCCGATTTATCGGGG - Intronic
955327120 3:58017409-58017431 AAAATGCAAAAAAATTATCCAGG - Intronic
955726885 3:61942704-61942726 TAAATGTAACAGAATTGTCCAGG - Intronic
955874201 3:63473169-63473191 AAAATGGGCCTGAGTTATCCAGG - Intronic
958500250 3:94896579-94896601 AAAATAGAAAAAATTTAGCCAGG + Intergenic
958724181 3:97883506-97883528 AAAATCAAACAGATTTAATCTGG + Intronic
959277161 3:104290766-104290788 ACAATGGACCAAATTTATCGTGG + Intergenic
959358639 3:105363781-105363803 AAAATGAATAACATTTATCCAGG - Intergenic
960425540 3:117502482-117502504 AAAACGGAATAGATTAATCCAGG + Intergenic
960882959 3:122364509-122364531 AAAAGGGTTCAGAATTATCCTGG + Intronic
963396592 3:144742300-144742322 ACAGTGGAACAGATTTATCTGGG - Intergenic
964285999 3:155119127-155119149 AAAAATGAAAAGATTTATCATGG + Intronic
964751431 3:160057580-160057602 AAAATGGAAATGGTTTATACAGG + Intergenic
964757796 3:160104542-160104564 AAAATGGAAATGGTTTATACAGG + Intergenic
964808976 3:160642007-160642029 AAAAGAAAACAAATTTATCCAGG + Intergenic
964973140 3:162585861-162585883 AAAATCGAATACATTAATCCTGG - Intergenic
966326955 3:178767518-178767540 AAGATGGAACAGATTTATGTGGG - Intronic
967225161 3:187284038-187284060 AAAATAGAACAAATTTCTCAGGG - Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968185238 3:196628746-196628768 AAAATGCAAAAGAATTAGCCAGG - Intergenic
969821811 4:9726544-9726566 AAAATGGAAATGGTTTATACTGG - Intergenic
970296082 4:14632015-14632037 AAAATGTAATTGATTTATCTGGG - Intergenic
970857604 4:20667001-20667023 AAAAAGGCTCAGAATTATCCTGG + Intergenic
971871411 4:32245063-32245085 AAAATTGAACAGTTTTAAACGGG - Intergenic
972096609 4:35354859-35354881 AAAATGCAAAAAATTTAGCCGGG + Intergenic
972336388 4:38110435-38110457 AAGAAGGAAAAGATTGATCCTGG + Intronic
972811620 4:42594491-42594513 AAAATGGAAGAAAATTATCTAGG + Intronic
973208417 4:47586939-47586961 TTAATGGAGCAGATTTGTCCGGG + Intronic
973235564 4:47899753-47899775 ATGATGGAACAGTTTTATACTGG + Intronic
973266240 4:48213992-48214014 AAAATGGAACAAAATTATGTGGG + Intronic
973626713 4:52779821-52779843 AATATGCAACAGAATTACCCTGG + Intergenic
973765922 4:54162583-54162605 AAAATACAACAAATTTTTCCTGG - Intronic
974622660 4:64381117-64381139 AAAATTGAATAAATTTAACCAGG - Intronic
975088183 4:70368106-70368128 AAAATACAACAGAATTAGCCAGG - Intergenic
975423213 4:74194237-74194259 AAAATTGAAGCGATATATCCAGG - Intronic
976299257 4:83502485-83502507 AAAATGTAACAGGTTTATAATGG - Intronic
977008299 4:91601313-91601335 AAAATCGAACTGTTTAATCCAGG - Exonic
977450871 4:97195559-97195581 AAAATGGAACAGAATAATAGAGG - Intronic
977637723 4:99319105-99319127 AAAATGGAATATATTTATTTAGG + Intronic
978489745 4:109300558-109300580 AAAATGGAACTTATTTAACAAGG - Intronic
979349187 4:119626827-119626849 TAAATTGAAAAGATTAATCCCGG + Intronic
980546114 4:134264377-134264399 GAAATGGGACTGCTTTATCCTGG - Intergenic
980570434 4:134609398-134609420 AAAATAGAACATATCTAACCAGG - Intergenic
980602893 4:135047764-135047786 TAAATTGAACAGGTTTGTCCAGG - Intergenic
981155937 4:141435060-141435082 AAGATGAAAAAGATTTCTCCAGG - Intergenic
981535755 4:145797781-145797803 TAAATGGAAATGATTTATTCTGG + Intronic
981962352 4:150555960-150555982 AAAAATGAACAGAATTAACCAGG - Intronic
984361488 4:178740638-178740660 CAAATTGAACAGAATTAGCCAGG - Intergenic
985112903 4:186564262-186564284 AAAATGCAAAAAATTTAGCCGGG - Intergenic
985233032 4:187842246-187842268 AAAATGCAAAAAATTTAGCCAGG + Intergenic
986942033 5:12965135-12965157 AACATGGAATAAATTTATTCAGG - Intergenic
987821742 5:22973734-22973756 AAAATTGAAAAGAATTATCAAGG - Intergenic
988137433 5:27192387-27192409 AAAATGGAACACTTATATACTGG + Intergenic
988294649 5:29340378-29340400 GTAAGGGATCAGATTTATCCAGG - Intergenic
988600519 5:32635747-32635769 AAAATAGAATAAATTTAGCCAGG - Intergenic
989150347 5:38292934-38292956 AACATAAAACAGAGTTATCCTGG + Intronic
989186951 5:38635202-38635224 AAAATGGAAATGGTTTATTCAGG + Intergenic
989311963 5:40029928-40029950 AAATTGCAACAGAGTTATTCTGG + Intergenic
989635614 5:43529797-43529819 AAAATGGAACAGATTTATCCGGG - Exonic
989963077 5:50439295-50439317 AAAAAGAAACAGAATTGTCCAGG - Intronic
990826316 5:59903037-59903059 AGAATGGAACAGGTTTACCTTGG - Intronic
990997646 5:61748566-61748588 AAAAACGAATAGATTTATCAGGG - Intronic
992085588 5:73275354-73275376 AAAATGGAACAGCTGTAGCTGGG + Intergenic
992102801 5:73423521-73423543 TAAATGGAACAGAGTTTCCCAGG + Intergenic
992630607 5:78676595-78676617 AGAATGGAACAGCTTTCTGCAGG + Intronic
993486848 5:88497337-88497359 AGAATGGGACATATTTTTCCCGG - Intergenic
993554123 5:89314446-89314468 CAAATGGAACACATCTGTCCAGG - Intergenic
993937408 5:94021208-94021230 AAAATGGAAATGGTTTATACAGG + Intronic
995153629 5:108882235-108882257 AAATTGGCACAGATTTTTCAGGG - Intronic
995287101 5:110402297-110402319 AAGATGTAAAAGATTTATTCAGG - Intronic
995445471 5:112237893-112237915 AAATTGGAACAGATTTAGCATGG + Intronic
996816626 5:127581576-127581598 AATGTGGTACAGATTTATCATGG + Intergenic
996968035 5:129329269-129329291 GAAATGGAACAGATGTCTCAGGG - Intergenic
997039458 5:130234482-130234504 AAAATGAAACAGAATTCTGCTGG - Intergenic
998384322 5:141747730-141747752 AAAATGGACCAGACTTTCCCTGG - Intergenic
998405532 5:141872475-141872497 ACCATGGTACAGATTTTTCCAGG + Intronic
999015089 5:148094133-148094155 AAAAAGGAAAAAATTTAGCCGGG + Intronic
999742074 5:154563602-154563624 AAAATGGAATAGTTTTTTTCTGG - Intergenic
999974478 5:156897162-156897184 AAAATTGAACAAATGAATCCTGG + Intergenic
1000277901 5:159755297-159755319 AAAATTAAACAGAGTTAGCCGGG - Intergenic
1000700882 5:164448307-164448329 AAAAAGAAACAGAAATATCCAGG + Intergenic
1000832511 5:166120758-166120780 AAAATAGAACAGACTTATTCAGG - Intergenic
1000846953 5:166293541-166293563 AAAATGCAGAAGATTTATCAAGG + Intergenic
1003102320 6:3186372-3186394 AAAATGGAATTGGTTTATGCAGG + Intergenic
1004089267 6:12483494-12483516 AGAAAGGAACAGATTTATTTTGG + Intergenic
1005897000 6:30186908-30186930 AAAATGGAACAGATTTTTCAGGG - Intronic
1006257469 6:32843274-32843296 AAAATGGAAAAGGTTGATACTGG - Intronic
1007144207 6:39611145-39611167 AAAATGCAAAAGAATTAGCCAGG + Intronic
1007366955 6:41401060-41401082 AAAAATAAACAGAATTATCCAGG - Intergenic
1007884600 6:45212003-45212025 AAAATGGAAAAAGTTTAGCCAGG + Intronic
1008130614 6:47716776-47716798 AAAATTGAACAGATTCATGAGGG - Intronic
1008309582 6:49950191-49950213 AAAATAGAAAAAAATTATCCGGG + Intergenic
1009653591 6:66509814-66509836 AAACTTGAACATATTTATTCTGG + Intergenic
1010363389 6:75021293-75021315 TACATGGAAAAGATTTAACCAGG + Intergenic
1011484984 6:87831604-87831626 AGCAAGGAAAAGATTTATCCTGG - Intergenic
1012112111 6:95249235-95249257 AAAATGCCACAGATTTCTACTGG - Intergenic
1012832301 6:104219502-104219524 AAAATAGAAAGGATTTATGCAGG + Intergenic
1012995322 6:105967123-105967145 TAAATGAAATAGATTTATACTGG + Intergenic
1013017368 6:106172345-106172367 AAAATGGAAAACAATTAGCCAGG + Intergenic
1013019021 6:106191964-106191986 AAAATGGAACTGAATAATTCAGG - Intronic
1013779380 6:113713211-113713233 AAAATGCAAAAGAATTAGCCAGG - Intergenic
1015619549 6:135116771-135116793 AAAATGTAACAAATGTTTCCTGG + Intergenic
1016125743 6:140400491-140400513 AAAATAGATCAGATCTGTCCAGG - Intergenic
1016975722 6:149805639-149805661 AAAATTGAACAAATTTAGGCTGG + Intronic
1017196273 6:151703972-151703994 AAAATGGAGGAGAATTATTCTGG - Intronic
1018082049 6:160267549-160267571 AAAATGGAAGTGGTTTATTCAGG + Intronic
1018526509 6:164716065-164716087 AAAATGTAAAAGATTAATCTAGG + Intergenic
1018973082 6:168542401-168542423 AAAAAGGAACACAATTCTCCTGG - Intronic
1019797042 7:3057972-3057994 AAAATGCAAAAAATTTAGCCAGG + Intergenic
1020038422 7:4981423-4981445 AAAATAGAACAAAATTAGCCGGG + Intergenic
1020750895 7:12140656-12140678 AACATTGACCAGGTTTATCCAGG - Intergenic
1020976828 7:15016945-15016967 AAAGTGTGGCAGATTTATCCGGG + Intergenic
1021349122 7:19567872-19567894 AAAATACAAAAAATTTATCCGGG - Intergenic
1022018749 7:26377560-26377582 AAAAAGGAAAAGATTTGGCCTGG + Intergenic
1022429559 7:30303120-30303142 AAAATAGAAAACAATTATCCGGG + Intronic
1022668902 7:32437013-32437035 AAAAAGGAACAGACTGATTCTGG - Intergenic
1023026583 7:36056350-36056372 AAAATGCAAGAGATTTATTGGGG + Intergenic
1023379739 7:39594914-39594936 AATATGGAGCAGATTTTTCTTGG - Intronic
1024459820 7:49648575-49648597 AAAATGGTAAAGAATTATCTTGG + Intergenic
1024810888 7:53210912-53210934 AATATGTAACAGATTAATCCAGG + Intergenic
1025010322 7:55391995-55392017 AAAATGGTAAAGATTTGGCCAGG + Intronic
1026362083 7:69611453-69611475 GAAATGGACCAGATTGTTCCAGG + Intronic
1026404519 7:70051288-70051310 AAACTGTTACAGATTTATTCAGG - Intronic
1027685255 7:81272540-81272562 AAAATGGAAGACACATATCCTGG - Intergenic
1027790171 7:82630968-82630990 AGAATTGAAGAGATTTATCCAGG + Intergenic
1027977398 7:85176873-85176895 AAAATGGATCACATATATCAAGG + Intronic
1028737278 7:94230967-94230989 AAAATAAAACAAATTTATCCTGG + Intergenic
1030996441 7:116364596-116364618 AAACTGGAAAAGATATAACCAGG + Intronic
1031859284 7:126959012-126959034 AACATGGAAAAAATTTAACCTGG + Intronic
1032152052 7:129437284-129437306 AAAATAAAAAAGATTTAGCCAGG + Intronic
1032157878 7:129484550-129484572 AAAATGGATAAGACTTGTCCTGG - Intronic
1032417780 7:131750635-131750657 AAACTGGTACAGACTTATTCAGG - Intergenic
1033653608 7:143359744-143359766 AAACTCGAACTGATTTCTCCTGG - Exonic
1035636387 8:1148994-1149016 TTAATTGATCAGATTTATCCAGG + Intergenic
1036802891 8:11806036-11806058 AAAATAGAATAGATTTCTCCAGG - Intronic
1039519254 8:38156606-38156628 AAAATAGATCAGTGTTATCCAGG + Intergenic
1041676012 8:60540638-60540660 AAAATGTAACAAAATTAGCCAGG - Intronic
1042754267 8:72193169-72193191 AAAATGGAACAGGTTTGGGCTGG + Intergenic
1042765810 8:72321068-72321090 AAAATGGAACAGGTTTGGGCTGG + Intergenic
1045681051 8:104660589-104660611 AACATGTAGCAGATTTATTCTGG - Intronic
1046117678 8:109803799-109803821 CTAATGAAAGAGATTTATCCTGG + Intergenic
1046363044 8:113186631-113186653 AAAATGGAAATGGTTTATACAGG - Intronic
1047049496 8:121095044-121095066 AAAATGGAACTCATTTATAAAGG + Intergenic
1048065180 8:130960436-130960458 GAAATGAAACCTATTTATCCTGG + Intronic
1048455747 8:134576842-134576864 AAATTTGAAAAGAATTATCCAGG - Intronic
1050347958 9:4711576-4711598 AAAACGGAACAGATTTTTAAAGG + Exonic
1051056114 9:12988663-12988685 AAAATAGAACAAATGTGTCCTGG - Intergenic
1051149493 9:14064869-14064891 AACCTGGACCAGATTTATTCTGG - Intergenic
1052481739 9:29037694-29037716 AAAATGGAACAGATTGGTAATGG - Intergenic
1052512183 9:29435805-29435827 AAACTTGAACAGATTTATTTGGG - Intergenic
1052742903 9:32410941-32410963 CACATGGAACAGAGTTGTCCCGG - Intronic
1054708285 9:68484866-68484888 AAACTGGAAAAGACCTATCCAGG - Intronic
1054969539 9:71069335-71069357 AAAATGCAAAAAATTTAGCCAGG - Intronic
1055223766 9:73969613-73969635 AAAATGAAACATATTTATAAGGG + Intergenic
1055502866 9:76919246-76919268 AAAATGGAAATAATTTCTCCAGG + Intergenic
1055525112 9:77125386-77125408 AAAATGGCCCAGTTTTATCTGGG + Intergenic
1056237063 9:84605169-84605191 CACATGGAACAAATTTATTCTGG + Intergenic
1056383938 9:86080051-86080073 AAGATGGAACACATTTTTCCTGG - Intronic
1056588174 9:87942132-87942154 AAAATGCAACTGATTATTCCTGG - Intergenic
1056608692 9:88110813-88110835 AAAATGCAACTGATTATTCCTGG + Intergenic
1057548157 9:96033403-96033425 AAAATGCAAAAAATTTAGCCAGG - Intergenic
1058863196 9:109137662-109137684 AAAAAAGAACAGATTTATAATGG + Intronic
1059538241 9:115104287-115104309 GAAATGGAAGAGATTTATCTAGG + Intronic
1060469108 9:123932564-123932586 AAAATAGAAAAAATTTAGCCGGG + Intergenic
1060672371 9:125481092-125481114 AAAAGGGAAAAGACTTGTCCAGG + Intronic
1185553576 X:1002911-1002933 AAATGGGAACAGATGTAGCCGGG - Intergenic
1186992381 X:15084271-15084293 AAAATGGGAAAAATTTTTCCAGG + Intergenic
1189183895 X:39034650-39034672 ACAAAGGAACAGAATTTTCCAGG - Intergenic
1189510321 X:41655551-41655573 AAAATGGAAATGGTTTATGCAGG + Intronic
1189516095 X:41714853-41714875 AAAATGGAAATGGTTTATACAGG + Intronic
1190791145 X:53701525-53701547 AAATTTGAACAGATTTATGAAGG + Intergenic
1190791697 X:53706621-53706643 AAATTTGAACAGATTTATGAAGG + Intergenic
1190999174 X:55641872-55641894 AAAATGTAACAGATTCATAAAGG + Intergenic
1192954556 X:76055097-76055119 AAAAGGGAACACTTTTATACTGG - Intergenic
1195811286 X:108833413-108833435 AAAGTGGAAGAGATTTAATCTGG - Intergenic
1198047742 X:132919357-132919379 AAAATGGAAAAATTTTATCATGG - Intronic
1198974284 X:142318248-142318270 AAAATAGAAAAAATTTAGCCGGG + Intergenic
1199056478 X:143301625-143301647 AAGCTGGAACACATTTGTCCAGG + Intergenic
1199149074 X:144407650-144407672 AAAATGAAATAAATTAATCCTGG + Intergenic
1200708249 Y:6461437-6461459 AAAGTGGAATAGATTGATGCCGG - Intergenic
1201025863 Y:9703271-9703293 AAAGTGGAATAGATTGATGCCGG + Intergenic