ID: 989635727

View in Genome Browser
Species Human (GRCh38)
Location 5:43530905-43530927
Sequence TCTTGGGCCCCATGTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989635721_989635727 1 Left 989635721 5:43530881-43530903 CCCACAGAAAGCCAGAAAGCAAG 0: 1
1: 2
2: 10
3: 71
4: 656
Right 989635727 5:43530905-43530927 TCTTGGGCCCCATGTGAAACAGG 0: 1
1: 0
2: 0
3: 9
4: 113
989635722_989635727 0 Left 989635722 5:43530882-43530904 CCACAGAAAGCCAGAAAGCAAGG 0: 1
1: 0
2: 9
3: 53
4: 389
Right 989635727 5:43530905-43530927 TCTTGGGCCCCATGTGAAACAGG 0: 1
1: 0
2: 0
3: 9
4: 113
989635726_989635727 -10 Left 989635726 5:43530892-43530914 CCAGAAAGCAAGGTCTTGGGCCC 0: 1
1: 0
2: 0
3: 6
4: 131
Right 989635727 5:43530905-43530927 TCTTGGGCCCCATGTGAAACAGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989635727 Original CRISPR TCTTGGGCCCCATGTGAAAC AGG Intronic
904091636 1:27949077-27949099 TCATGTGCCCGATGAGAAACTGG + Exonic
904666680 1:32127392-32127414 TCTAAGGCCCCATGTGAGAAAGG - Intronic
906370537 1:45249335-45249357 ATTTGTGCCCCATTTGAAACTGG - Intronic
918460663 1:184773432-184773454 TCTTGGTCACCCTGTGAATCTGG + Intergenic
920427847 1:205892656-205892678 TCCTGGGCCCCATTCCAAACTGG + Intergenic
1062824930 10:560092-560114 TCTTGGTTTCCCTGTGAAACTGG - Intronic
1066792560 10:39081888-39081910 ATTTGGGCCACATGTCAAACAGG - Intergenic
1068166614 10:53339719-53339741 TCCTGGGCCCCATTCTAAACTGG - Intergenic
1069341987 10:67421524-67421546 TCATGGTCCCCATGTGACAATGG - Intronic
1076885976 10:133262605-133262627 TCTTGAATCCCATGGGAAACAGG + Exonic
1081375614 11:42354521-42354543 TGTTGGGGCCTATGTAAAACTGG - Intergenic
1084495200 11:69499337-69499359 TCCAGGGCCCCACGTGACACTGG - Intergenic
1085117409 11:73942030-73942052 ATTTGGGCCACATGTCAAACAGG - Intergenic
1087529018 11:99355409-99355431 TTTGGGGTCTCATGTGAAACTGG - Intronic
1092159134 12:6306136-6306158 TCTGGGGCCGCATGTCAAAAGGG + Intergenic
1093804463 12:23415307-23415329 AGTTGGGCCCCATGAGAAATAGG + Intergenic
1094526007 12:31231788-31231810 TCCAGGGCCCCATGAGAATCAGG + Intergenic
1111202932 13:84962476-84962498 TCCTGGGCCCCAAGTGCACCTGG + Intergenic
1112326653 13:98446297-98446319 TCTTGGGCTCCAGGTGTCACGGG + Intronic
1122167500 14:99839735-99839757 TCTTGAGCTTCATTTGAAACAGG + Intronic
1122307217 14:100773600-100773622 TCATGGGCCCCAGGGGAAGCAGG - Intergenic
1124479761 15:30068225-30068247 TCTTGGGCCTGATGGGAAGCAGG - Intergenic
1127003715 15:54541424-54541446 TCTTTGGCTCTCTGTGAAACAGG + Intronic
1128525623 15:68410399-68410421 TCTTGGGGCCCAAGTAAAACTGG - Intronic
1130092344 15:80831433-80831455 TCCTGTGCCCACTGTGAAACTGG - Intronic
1132967183 16:2663875-2663897 ATTTGGGCCACTTGTGAAACGGG - Intergenic
1133781269 16:8941108-8941130 GCATGGGCCCCATGTGAATTGGG - Intronic
1135087829 16:19488952-19488974 TTTTAGGACACATGTGAAACTGG + Intronic
1137759816 16:50931385-50931407 TCTTGGGAACCCTATGAAACAGG + Intergenic
1142006800 16:87693054-87693076 TCTTGGGCCCCATGACAACTTGG - Intronic
1144060108 17:11575547-11575569 TCTTGTGCCCCATGGAAAACAGG - Intergenic
1145787587 17:27604084-27604106 GGTGGGGCCGCATGTGAAACTGG + Intronic
1148741540 17:49895930-49895952 TCTTGGGCACCATCTGGAACAGG - Intergenic
1151588672 17:75028519-75028541 ACTTGGGCCACATGTCAAACAGG + Intergenic
1153285768 18:3452600-3452622 TCCTCGGCCTCAAGTGAAACAGG - Intronic
1156442972 18:37210172-37210194 TCTTGGACACCATGTCAAACTGG + Intronic
1157710330 18:49845796-49845818 TCTTGTGCCCCATCTGCCACAGG - Intronic
1160250921 18:77202873-77202895 TCTTCAGCTCCATGAGAAACTGG + Intergenic
1160932685 19:1578086-1578108 TCCTCGGCCCCACGTGAACCAGG - Exonic
1163334145 19:16660564-16660586 TCCTGGGCCCCATGGGGAACGGG + Intergenic
1164684826 19:30159717-30159739 TCTTGGGCCCTGTGGGAAGCAGG - Intergenic
1166428181 19:42698159-42698181 CCATGGGCCCCATGTGGAGCCGG - Intronic
1166659121 19:44634193-44634215 TCCTGGGCCCCATTCCAAACTGG - Intronic
925175563 2:1781413-1781435 TCCTGGGCTCCATGTCACACAGG + Intergenic
925188331 2:1864485-1864507 TGTGGGGCCCCATGTTGAACGGG - Intronic
926771102 2:16376088-16376110 TCTTTGGCACCATGTGACTCTGG - Intergenic
927118120 2:19925004-19925026 TCCTGGGCCCCATTCCAAACTGG + Intronic
927605917 2:24486501-24486523 TTTTTGCCTCCATGTGAAACTGG - Intergenic
935915720 2:107947414-107947436 TCATGGGCCCCATTCCAAACTGG - Intergenic
939617566 2:144378160-144378182 TCATGGACACCATGTGGAACAGG + Intergenic
944572235 2:201056325-201056347 TCCTAGGCCCCATTTAAAACTGG - Intronic
1169425023 20:5489708-5489730 TCCCAGGTCCCATGTGAAACAGG + Intergenic
1173332647 20:42088041-42088063 TCTTGTGCCCCTTGGGAACCAGG - Intronic
1174732112 20:52928031-52928053 TCTTGGGCTCCCAGTCAAACTGG + Intergenic
1174768701 20:53277680-53277702 TCTTGGTACCCTTGGGAAACAGG - Intronic
1175204713 20:57302747-57302769 TCTTGAGCCCTCTGTGAAGCAGG + Intergenic
1175507357 20:59495355-59495377 TCTTGGGCACCACGGGACACAGG - Intergenic
1182180662 22:28344783-28344805 GCTCTGTCCCCATGTGAAACCGG + Intronic
950542897 3:13622674-13622696 TCTTAGGCCCCATGTGGGCCAGG + Intronic
950725803 3:14916109-14916131 CATTTGGCCCCATGTGAAAAGGG + Intronic
951711661 3:25590008-25590030 GGATGGCCCCCATGTGAAACAGG - Intronic
953138017 3:40200343-40200365 TCTTGGGCCACATGGGGCACGGG + Intronic
954453404 3:50583891-50583913 TCTGGGGCCCCCTGTGGATCTGG + Exonic
958633100 3:96705970-96705992 TCTTGTGCCAGATGTGAAATGGG - Intergenic
961513626 3:127419703-127419725 TCTGGGGACCCATGGGAAAGAGG - Intergenic
961845819 3:129762118-129762140 TCTTGAGCCCCAAGTGACAGAGG - Intronic
965370850 3:167860377-167860399 TCTTGGGCACCATGTTCACCAGG - Intergenic
965446756 3:168782467-168782489 TTTTGGGCCCCATGTAAATCAGG + Intergenic
966968279 3:185017812-185017834 TCCTGGGCCCCATTCCAAACCGG - Intronic
967770545 3:193329720-193329742 GCTTGGTCCCCAGGTGAAAGGGG - Intronic
972645236 4:40961712-40961734 TCTTGGGCCAGATGAGAATCAGG - Intronic
973008571 4:45044014-45044036 TCCTGGGCCCCATTCCAAACAGG + Intergenic
975352205 4:73359105-73359127 TCCTGGGCCCCATTCCAAACGGG + Intergenic
975600919 4:76098567-76098589 GCCTGGGCAACATGTGAAACTGG + Intronic
977443672 4:97101506-97101528 TCCTGGGCCCCGTATCAAACTGG - Intergenic
981433219 4:144686983-144687005 TCTTGGGCCCCATGACAGAGTGG + Intronic
982065388 4:151650150-151650172 CCTTGGGCTCACTGTGAAACGGG - Exonic
984222366 4:176993931-176993953 TCATGGGCCCCCTGTTAAACTGG - Intergenic
985560169 5:581588-581610 TATTGGGCTCCATAGGAAACAGG + Intergenic
985777539 5:1852591-1852613 CCTTGGGCCCCGTGTGAACGTGG + Intergenic
988787541 5:34578648-34578670 TCTTGGCACCCATGAGAAGCTGG - Intergenic
989635727 5:43530905-43530927 TCTTGGGCCCCATGTGAAACAGG + Intronic
989742560 5:44790006-44790028 TCCTGGGCCCCATTCTAAACTGG + Intergenic
990342043 5:54833419-54833441 ACTAGGGCCCCAGATGAAACAGG + Intergenic
992296281 5:75330141-75330163 TCTTGGACCACAAGTGACACTGG + Intergenic
993405980 5:87512297-87512319 TCCTGGGCCCCATTCTAAACTGG + Intergenic
996345484 5:122483943-122483965 TCTAGGGCCCCTTGTTAAAAAGG - Intergenic
997953716 5:138262225-138262247 TCTTTGGCCACATTTGAAAAGGG - Intronic
1002269126 5:178058176-178058198 TCCAGGGCCCCTTGAGAAACAGG - Intergenic
1005658511 6:27967903-27967925 TCTTGGACTCCATCTGGAACTGG + Intergenic
1007736940 6:43987698-43987720 TCTGGGGCCCCATGAGAACAGGG - Intergenic
1008399319 6:51046460-51046482 TCTTCCTCCCCATGTGAAAAAGG - Intergenic
1013475261 6:110501138-110501160 TCCTGGGCCCCATTCTAAACTGG + Intergenic
1019106269 6:169669844-169669866 TCATGGGCCTCATGTGTAATAGG - Intronic
1019700542 7:2472907-2472929 TCTGGGGACCTCTGTGAAACAGG - Intergenic
1022558277 7:31322797-31322819 TCTTAGGCTCCATGTCAAAGGGG + Intergenic
1024459526 7:49645683-49645705 TCTTGTCCCCCATGATAAACTGG + Intergenic
1024911288 7:54450130-54450152 TCCTGGGCCCCATTCTAAACTGG + Intergenic
1030102686 7:105960513-105960535 TCCTGGGTCTCATGTGAAGCTGG + Intronic
1031628723 7:124020711-124020733 TCTTGGGCCCCACTCAAAACTGG - Intergenic
1032101378 7:128981295-128981317 TTTTGGGACCCATGTATAACTGG - Intronic
1032165069 7:129539080-129539102 TCTTGGGGGCCTTGTGAACCTGG + Intergenic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1034904934 7:154935607-154935629 TTTTGGGCACCATGTGAAGATGG - Intronic
1035784892 8:2252622-2252644 CCTTGGGACCCATGGGAAATGGG + Intergenic
1035807916 8:2469099-2469121 CCTTGGGACCCATGGGAAATGGG - Intergenic
1036929860 8:12945347-12945369 TCTTTTGCCCCTTGGGAAACTGG - Intergenic
1039904194 8:41774232-41774254 TTTTGTGCCCCATGTCAACCAGG + Intronic
1043250897 8:78071805-78071827 TCTTGTGCCCTATGTAAATCAGG - Intergenic
1047282993 8:123461846-123461868 TCTTGTGCCCCATGTCAAGAAGG - Intronic
1047483802 8:125309763-125309785 TCCACGGCCTCATGTGAAACTGG - Intronic
1049612751 8:143563003-143563025 TCCTGGGCCCCATGGTAGACTGG - Exonic
1055852238 9:80645348-80645370 TATTGGTCTCCATCTGAAACTGG - Intergenic
1055932483 9:81573790-81573812 TCTTTGCACCCATCTGAAACTGG + Intergenic
1057949520 9:99358849-99358871 TCATGAGCCCCATGAGAAGCAGG + Intergenic
1062123699 9:134848269-134848291 TCATGGGTCCCATGTGCAAATGG - Intergenic
1186979286 X:14941605-14941627 TCTTGGGAACCGTGTGAAAATGG + Intergenic
1187413544 X:19072083-19072105 TCCTGGGCCACATGTGACCCGGG - Intronic
1194536109 X:95107288-95107310 TCCTGGGCCCCATTCCAAACTGG - Intergenic
1195059998 X:101184911-101184933 ATTTGGGCCACATGTCAAACAGG - Intergenic
1198101210 X:133423418-133423440 TTTTAGGCCCCATGAGAGACAGG - Intergenic
1200247538 X:154534124-154534146 TCTTCGGCCCCATCTGGAACCGG - Exonic
1201279078 Y:12325408-12325430 TATCGGGCCACATGTTAAACAGG + Intergenic