ID: 989638983

View in Genome Browser
Species Human (GRCh38)
Location 5:43565133-43565155
Sequence CAGAAAGACGTTACTGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989638983_989638987 -9 Left 989638983 5:43565133-43565155 CCCTTTCCAGTAACGTCTTTCTG No data
Right 989638987 5:43565147-43565169 GTCTTTCTGGTGAACCACAAAGG No data
989638983_989638988 -8 Left 989638983 5:43565133-43565155 CCCTTTCCAGTAACGTCTTTCTG No data
Right 989638988 5:43565148-43565170 TCTTTCTGGTGAACCACAAAGGG No data
989638983_989638990 22 Left 989638983 5:43565133-43565155 CCCTTTCCAGTAACGTCTTTCTG No data
Right 989638990 5:43565178-43565200 TGAAGAGACCCCTGACCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989638983 Original CRISPR CAGAAAGACGTTACTGGAAA GGG (reversed) Intergenic
No off target data available for this crispr