ID: 989651250

View in Genome Browser
Species Human (GRCh38)
Location 5:43692947-43692969
Sequence CTTTGAGTATGTGAGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 314}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989651250 Original CRISPR CTTTGAGTATGTGAGAAAGA AGG (reversed) Intronic
905121044 1:35682153-35682175 CTTTGAGAGTCTGAGAAGGAAGG + Intergenic
905702637 1:40029839-40029861 GTGTGTGTATGTGAGAGAGAGGG - Intergenic
906471445 1:46133917-46133939 GAATGAGTATGTGAGGAAGAGGG - Intronic
907392819 1:54169390-54169412 GTTTGAGTTTATGAGGAAGAGGG + Intronic
910514277 1:88040656-88040678 TTCTGAGGATATGAGAAAGAAGG - Intergenic
910555402 1:88526663-88526685 CTTTAAATAACTGAGAAAGATGG + Intergenic
911307392 1:96247547-96247569 CATCCAGTATGGGAGAAAGATGG - Intergenic
911469015 1:98293268-98293290 ATGTGTGTATGTGAGAGAGAAGG - Intergenic
911469311 1:98297254-98297276 CTCAAAGCATGTGAGAAAGAAGG + Intergenic
911471572 1:98325659-98325681 ATTTGAGCATTTGAAAAAGAAGG - Intergenic
911894219 1:103409274-103409296 CTTTTATTATGTGAGAAAAAAGG - Intergenic
913152825 1:116062388-116062410 CATTGATTATGTGAGTAAGAGGG + Intronic
914768542 1:150661929-150661951 CTTTGAGAAAAGGAGAAAGAAGG + Intronic
915015819 1:152732364-152732386 TTTTGAGTATGTCCTAAAGAAGG - Intergenic
916326426 1:163565008-163565030 CTTTGAGAATGGGAGAATGAGGG + Intergenic
919141543 1:193578810-193578832 CTTGGAGTCTGTGACAAAGTAGG + Intergenic
919648295 1:200118901-200118923 GTTTCAGAATGTGTGAAAGAAGG - Intronic
921822456 1:219633045-219633067 TATAGAGTATGTGAAAAAGAAGG + Intergenic
922018520 1:221677727-221677749 CTTTGAGTATGTTACAAATTGGG + Intergenic
923969082 1:239179343-239179365 CTTAGAGTTTGAAAGAAAGAGGG - Intergenic
924294497 1:242571496-242571518 ATATGAATATGAGAGAAAGATGG - Intergenic
924591536 1:245408992-245409014 CTTTGAGGATGTGAAACAGGTGG - Intronic
1062840398 10:666102-666124 CTGTGAGTTCGTGGGAAAGAAGG + Intronic
1064414728 10:15139095-15139117 CATCCAGTATGGGAGAAAGATGG - Intronic
1064721683 10:18235725-18235747 CTTTGACTGTATGAGGAAGAGGG + Intronic
1064927916 10:20590454-20590476 CTTTGAGTAGATGAGGAAGTGGG - Intergenic
1065091233 10:22235762-22235784 ATTTTAGTAGGTGAGATAGATGG - Intergenic
1065279645 10:24121852-24121874 CATTGAGTATGTAATAAAGGTGG - Intronic
1066223515 10:33359142-33359164 CTTTAATTATGTAAGAAAAAAGG - Intergenic
1067807575 10:49403924-49403946 CTTTGCGTGTGTGAGAGAGTGGG - Intergenic
1067816633 10:49482584-49482606 CATTCAGAATGTGAGAAAGATGG - Intronic
1069505047 10:68989940-68989962 CTTTGAGAAGGTGAGCCAGAAGG - Intronic
1070139865 10:73731127-73731149 GTTGGGGTAGGTGAGAAAGAAGG - Intergenic
1070478836 10:76859202-76859224 CATTTAGCATATGAGAAAGATGG - Intergenic
1070526355 10:77299145-77299167 CTTTTGGCATGTGATAAAGATGG + Intronic
1071485709 10:86101022-86101044 CTTTAAGGAAGTGAGAGAGAAGG + Intronic
1072834133 10:98693071-98693093 GTTAGAGTAATTGAGAAAGAGGG + Intronic
1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG + Exonic
1075936853 10:126350426-126350448 CTTTGAGAAAGGGAGGAAGAGGG + Intronic
1076553234 10:131301285-131301307 AATTGAGGAGGTGAGAAAGAAGG - Intronic
1078111536 11:8397618-8397640 CTTTGACGAGTTGAGAAAGAAGG + Intronic
1078165829 11:8884067-8884089 TTTTGAAGATGTGAGAGAGATGG - Intronic
1079967490 11:26996217-26996239 CTTAGAGTATATGATAAAGAAGG + Intergenic
1081272531 11:41102890-41102912 TTTTAAGTATGTGAAAATGAAGG + Intronic
1081439198 11:43061825-43061847 CGTTCAGCATGGGAGAAAGATGG + Intergenic
1081514364 11:43811069-43811091 CTTTGAGTAGGAGTGAAGGATGG - Intronic
1081717207 11:45258861-45258883 CTTTGTGTAGGGTAGAAAGACGG - Intronic
1082081519 11:48015965-48015987 CACTGAGTATGTTGGAAAGAGGG - Intronic
1083380263 11:62261766-62261788 TTTGGAGTAGGGGAGAAAGAAGG - Intergenic
1084000633 11:66293599-66293621 TTTTGAGTTGATGAGAAAGAGGG - Intronic
1084264310 11:67997044-67997066 GTGTGTGTATGTGAGAGAGAGGG - Intronic
1084351237 11:68601309-68601331 CTCTGAGTTTGTGGGAATGAGGG + Intronic
1084903801 11:72330434-72330456 CTTTGAGTATGACAAGAAGAAGG + Intronic
1085655088 11:78306869-78306891 CTGTGACTATGTGAGATGGATGG - Intronic
1086604210 11:88675768-88675790 CTTTGACTCTGTGAGAAACATGG - Intronic
1086807294 11:91260378-91260400 ATTTGGGTAAGTGAGAAATATGG + Intergenic
1086880388 11:92146775-92146797 CCTTGAGGATGTCAGAAAGATGG - Intergenic
1086978172 11:93161764-93161786 CTTTGCGTATGTGAAAACTAAGG + Intronic
1088352038 11:108900426-108900448 CTTTAAGTATTTTAGAAAGGTGG - Intronic
1088580383 11:111310118-111310140 CTTTGTGTATATGAGGAAGTTGG - Intergenic
1088721615 11:112597030-112597052 CTTTTACTATGTGGGCAAGATGG - Intergenic
1089022727 11:115233857-115233879 CTCTTAGTATGTGACAAAGAGGG + Intronic
1089164926 11:116468494-116468516 CTTTGATTAAGGGAGAGAGATGG - Intergenic
1089598489 11:119598106-119598128 CTTTGTGTGTGGGAGAAGGATGG + Intergenic
1090992290 11:131829004-131829026 TTGTGTGTATGTGAGAGAGAGGG - Intronic
1091181455 11:133608106-133608128 CTCTGAGGAGGTGAGAAAGAGGG - Intergenic
1093090311 12:14913093-14913115 TTGTGAGTATGGGGGAAAGATGG + Intergenic
1095180658 12:39144162-39144184 CTTTGAGAACATGACAAAGAAGG - Intergenic
1095368504 12:41438052-41438074 CTTTGTGTTTGTCTGAAAGACGG + Intronic
1097266645 12:57749437-57749459 CTTTGAGTAAGTGACCAACATGG - Exonic
1098604562 12:72374172-72374194 CATGGAGTGTGAGAGAAAGAGGG + Intronic
1100217771 12:92470199-92470221 CTATTAGTCTGAGAGAAAGAGGG - Intergenic
1103432301 12:120899125-120899147 CTCAGTGTATGTGAGAAAAAAGG + Intronic
1104277695 12:127344698-127344720 GTGTGAGTCTGTGAGACAGAGGG - Intergenic
1106318771 13:28618920-28618942 CTCTGTGTGTGTGAGAGAGAAGG - Intergenic
1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG + Intergenic
1112716631 13:102193505-102193527 CCTTGAGTATCTGAGCAAGCAGG + Intronic
1112996537 13:105581084-105581106 GTTTGGGTAAGTTAGAAAGAAGG - Intergenic
1115184496 14:30669642-30669664 CTTAAAGTTTGTGTGAAAGAGGG + Intronic
1115587480 14:34829016-34829038 CTTTGAGAGGGTGAGAAAGGCGG + Intronic
1115993655 14:39174313-39174335 CTTTCAGTTTGTGAGAAATAAGG + Intergenic
1116224393 14:42130312-42130334 ATTTGTGTATGAGAGAAAGCTGG + Intergenic
1117376061 14:55119451-55119473 CCTTTAGTTGGTGAGAAAGAGGG - Intergenic
1117555493 14:56879264-56879286 CTTTGGGAAGCTGAGAAAGATGG + Intergenic
1118053628 14:62055986-62056008 CATTCAGTGTGGGAGAAAGATGG + Intronic
1119027397 14:71165050-71165072 CTTTGTGTGTGTGAAAAATAAGG - Intergenic
1120644516 14:87057754-87057776 ATGTTAGTATGTGAAAAAGAAGG - Intergenic
1121061000 14:90909496-90909518 CTTTCCGTATCTGTGAAAGAAGG - Intronic
1124491533 15:30160375-30160397 CTTTGAGTATGGCATAAGGAAGG + Intergenic
1124752004 15:32377931-32377953 CTTTGAGTATGGCATAAGGAAGG - Intergenic
1125893978 15:43286719-43286741 CTGTGAAGATGAGAGAAAGATGG - Intronic
1128001331 15:64195329-64195351 TTGTGGGTATGTGAAAAAGAAGG - Intronic
1129633865 15:77293225-77293247 TTTGGAGTATGAGATAAAGAGGG - Intronic
1131250116 15:90824944-90824966 CTTTGACAACCTGAGAAAGATGG - Intergenic
1132317965 15:100903980-100904002 TTTTGAGTATGTAAAAAAAATGG - Intronic
1134049319 16:11125930-11125952 CTCTGAGCATGTGGGATAGAGGG - Intronic
1135570217 16:23543502-23543524 CTTTGGGAATCTGAGAAAGGTGG + Intronic
1136414087 16:30092924-30092946 CTCTGTGTTTGTGAGAAATACGG - Intronic
1136624944 16:31456684-31456706 CTTTGTGTATGTGAGAGCCAGGG - Intergenic
1138298004 16:55903170-55903192 CTTTGAGTTGGTGAGAAACAGGG + Intronic
1139454218 16:67059370-67059392 CTTTGTGTCTGTGAGAGAAAAGG + Intronic
1139611188 16:68060103-68060125 CATTGAGTATGATAGGAAGAAGG + Intronic
1139966807 16:70750344-70750366 CTTTTTGTGTGAGAGAAAGAAGG + Intronic
1140338240 16:74132023-74132045 CTTTGAGAGTGTGAGAAAGGAGG - Intergenic
1143973561 17:10813461-10813483 CTATGAGAATGTGATAAAGAGGG + Intergenic
1144427481 17:15157436-15157458 CTTTGAGTGTGGGTGAAAGCTGG - Intergenic
1145020891 17:19429818-19429840 CTTTGTGTGTGTGAGAAAGCTGG - Intergenic
1146582348 17:34049882-34049904 ATTTCAATATGTGAGAAACAGGG - Intronic
1148663460 17:49356062-49356084 CTTTGAGAATGTGCTAAAAAAGG + Intronic
1150696883 17:67413005-67413027 TTTTGAGAATCTGAGAATGATGG + Intronic
1152928458 17:83098562-83098584 CTCTGTGTGTGTGAGAGAGAGGG + Intergenic
1153224264 18:2886190-2886212 CTTGGAATAAGTGAGAAAAAAGG + Intronic
1154231898 18:12564162-12564184 CCTTGAGTATGTGATAGAGCTGG - Intronic
1154261434 18:12836605-12836627 CTTTGAGTATTTAAGATAAAAGG - Intronic
1155333961 18:24746156-24746178 AAGTGAGTATGTGAGAAAGAGGG - Intergenic
1155520180 18:26659671-26659693 CATTAAGTAGATGAGAAAGATGG + Intergenic
1155532092 18:26777535-26777557 CTTTGGGTCTGAGAAAAAGAAGG - Intergenic
1155544076 18:26897073-26897095 CTTTCAGAGTGTGAGATAGATGG + Intergenic
1155551238 18:26967900-26967922 CATCCAGTATGGGAGAAAGATGG - Intronic
1155589486 18:27410334-27410356 CATTGAGAATGGGAGAAAGATGG - Intergenic
1155644103 18:28056484-28056506 CTTTGATTATGTAAGAAAACTGG + Intronic
1155840727 18:30639447-30639469 CTGACAGTATGTGAGAAGGAGGG + Intergenic
1155942869 18:31817102-31817124 CTTTCAGTTTGGGAGGAAGATGG - Intergenic
1156107333 18:33679650-33679672 TTGTGTGTATGTGGGAAAGAGGG + Intronic
1157283062 18:46358757-46358779 CCCTGAGCATGTGAGAAGGAAGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158086615 18:53658581-53658603 CTGTTAGTTTGTGAGAATGATGG + Intergenic
1158495175 18:57948909-57948931 CTTTGAGTTTGTGAGAAAACTGG - Intergenic
1158695330 18:59697942-59697964 CTTAGATTATGTGAGGAAGGAGG + Intergenic
1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG + Intergenic
1158917811 18:62153055-62153077 ATTTGAGGAAGTGAGAAAGAAGG - Intronic
1159324395 18:66895542-66895564 CTGTGTGTGTGTGAGAGAGAGGG + Intergenic
1159686668 18:71430313-71430335 CTTTCAGAATGTGAGAAAACTGG - Intergenic
1163457873 19:17419334-17419356 CTTTGTGTAGGTGGCAAAGAAGG - Exonic
1164999071 19:32745609-32745631 TATTGTGTATGTGTGAAAGAGGG + Intronic
1168456005 19:56508963-56508985 TTATGAGTTTGTGAGAGAGAGGG + Intronic
926985798 2:18621911-18621933 CTTGTAGTATATGAGAATGATGG + Intergenic
928746107 2:34417876-34417898 CTGTGAGTTTGTGACAATGAGGG - Intergenic
929335448 2:40738542-40738564 CATTGAGTAGCTGAGGAAGAAGG - Intergenic
930704550 2:54491255-54491277 CTATTACTATGTGAAAAAGAAGG - Intronic
931497739 2:62828654-62828676 TTTTGAGTTTGTGGGTAAGAGGG - Intronic
931838982 2:66128925-66128947 TTTTGACTCTGGGAGAAAGAGGG + Intergenic
932215000 2:69960953-69960975 CTTTGAGAATGTGGTAAAGGTGG - Exonic
932580411 2:72989673-72989695 CTTTGCGGAGGAGAGAAAGATGG + Intronic
932834722 2:75025637-75025659 CTGTGTTTATGTGAGATAGAGGG + Intergenic
933062296 2:77753589-77753611 CTATGAATATGTGAGATTGAAGG + Intergenic
934987349 2:98897176-98897198 CTTTGAGAATGTCACAAAAATGG + Intronic
935078222 2:99766907-99766929 CTATGAGAAGGTGAGAAGGAAGG + Intronic
935832199 2:107011802-107011824 CTTGGAGCAGGAGAGAAAGAGGG - Intergenic
937484288 2:122297884-122297906 AGTTGAGTATGTGAGACAGTGGG + Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
939748669 2:146012032-146012054 GTTTGTGTATGAGAGAGAGAGGG + Intergenic
943435193 2:187856881-187856903 CTGTGACTTTGGGAGAAAGAAGG + Intergenic
943786733 2:191885763-191885785 GTTTGAGAATGGGAGGAAGAAGG + Intergenic
944584852 2:201164505-201164527 CATTCAGCATGAGAGAAAGATGG + Exonic
944899001 2:204195534-204195556 CATTTAGGATGTCAGAAAGAGGG - Intergenic
945590344 2:211721297-211721319 CTTTGTGTATGTGATACAGTAGG - Intronic
945617043 2:212084433-212084455 ATTTGAGAATCTGAGTAAGAGGG - Intronic
945831875 2:214797205-214797227 CTTTGAGAAAGTGAGAAATATGG - Intronic
946595958 2:221306293-221306315 CATTGAGAATTTAAGAAAGAGGG - Intergenic
947603236 2:231467575-231467597 CATTGAGTATTTAAAAAAGAGGG + Intronic
948146015 2:235708534-235708556 TTTAGACTATGTCAGAAAGATGG - Intronic
1168884279 20:1235227-1235249 CAATGAGTATAGGAGAAAGATGG + Intronic
1169607355 20:7337654-7337676 CTTTGATTATGGGTAAAAGATGG - Intergenic
1172097875 20:32469213-32469235 CAATGACTATGTGAGAAAAAAGG + Intronic
1173019817 20:39257783-39257805 CTTTAAGTATTTGGGATAGAGGG - Intergenic
1173187545 20:40852434-40852456 CTTTGAGAATATGAGAATAAGGG + Intergenic
1173754245 20:45500987-45501009 CTTTGACTACTTGAGTAAGATGG + Intergenic
1176345948 21:5746718-5746740 CTTTGTGTATTTGAGCAAGATGG - Intergenic
1176352762 21:5867302-5867324 CTTTGTGTATTTGAGCAAGATGG - Intergenic
1176498879 21:7577737-7577759 CTTTGTGTATTTGAGCAAGATGG + Intergenic
1176540269 21:8144788-8144810 CTTTGTGTATTTGAGCAAGATGG - Intergenic
1176559220 21:8327833-8327855 CTTTGTGTATTTGAGCAAGATGG - Intergenic
1177735921 21:25089962-25089984 CTTTGAGTTGGTGTGACAGAAGG - Intergenic
1178111788 21:29376452-29376474 CTTTGAGTGGGGAAGAAAGATGG + Intronic
1178565911 21:33684596-33684618 CTTTAATTATCTCAGAAAGAGGG + Intronic
1179037056 21:37767212-37767234 CTTTGTCTAGGTGAGAAAGATGG + Intronic
1181473028 22:23152446-23152468 GTTTGAGCCTGTGAGAAATATGG - Exonic
1182569207 22:31223699-31223721 CTTGGAGTTTGTGAGAGAGATGG + Intronic
1183659116 22:39208062-39208084 CTTTGAGTGCGTGAGAGAGGAGG - Intergenic
1184380350 22:44141416-44141438 CATCCAGTATGGGAGAAAGATGG + Intronic
1184909922 22:47524410-47524432 CTTTGACAATGTAAGAGAGATGG + Intergenic
1203245214 22_KI270733v1_random:61156-61178 CTTTGTGTATTTGAGCAAGATGG - Intergenic
949288482 3:2434744-2434766 CTTTGAGTCTGTCACAAAAACGG - Intronic
949372161 3:3347370-3347392 CATTTAGCATGGGAGAAAGATGG - Intergenic
950803055 3:15570595-15570617 CTTTCCCTATGTGAGAAAGGTGG - Intronic
951115023 3:18850768-18850790 TTTTGATTATGTAAGAAACAGGG - Intergenic
952027187 3:29098054-29098076 CTTTGAATATATGAGAAAATAGG - Intergenic
956216263 3:66852524-66852546 CTTCCAGCATGGGAGAAAGATGG + Intergenic
958079170 3:88723315-88723337 CATTGATTAAGTAAGAAAGATGG + Intergenic
958851178 3:99327450-99327472 CTTTGAGTGGGTGAGATACAGGG + Intergenic
959468355 3:106718539-106718561 CTTAGAGAATGTTAGAAAGTAGG - Intergenic
959533187 3:107456855-107456877 AGTTAAGTATGTGAGAAAGTTGG + Intergenic
959678993 3:109071270-109071292 CTTTGAGAATTTGAGAAATATGG + Intronic
959775112 3:110150283-110150305 CATTCAGCATGGGAGAAAGATGG - Intergenic
960747553 3:120907461-120907483 CTTTGTATATGTGAGGATGATGG + Intergenic
961178885 3:124860480-124860502 CTTTGGGTTTGGGAGAAAGCTGG + Intronic
961618780 3:128206638-128206660 CTTTTGATATGAGAGAAAGAGGG + Intronic
962825544 3:139096969-139096991 CTCTGAGTCTCTGAGGAAGAGGG - Intronic
963240407 3:142997394-142997416 TTTTGTGTGTGTGAGAAAGGGGG + Intronic
963667385 3:148206030-148206052 CTTTGAACTTGTGAGAAAGTAGG - Intergenic
963744662 3:149114340-149114362 TTTTGTGGATGTGAGACAGAGGG - Intergenic
964862618 3:161219411-161219433 CTTTGGGTATCTCAGTAAGAGGG - Intronic
965031618 3:163376428-163376450 CTTTTAGTATTTGAGAATAATGG - Intergenic
965175882 3:165331628-165331650 TTTTCATTATGTGAGAATGAGGG - Intergenic
965471946 3:169104620-169104642 GTCTGAGTATGTCAGCAAGATGG - Intronic
965702437 3:171471876-171471898 CTGTGACTAGATGAGAAAGATGG - Intergenic
965898610 3:173611001-173611023 CCTTCAGTAGGTGAGAAAGGTGG + Intronic
966366587 3:179194607-179194629 GGTGGAGTATGTGACAAAGAAGG - Intronic
966881461 3:184353474-184353496 CTCTGAGTGTGAGAGAAGGACGG - Intronic
967833647 3:193943125-193943147 CTATGAGAAGGTGAGAGAGAAGG + Intergenic
968670025 4:1844375-1844397 CTTTGTTTCTATGAGAAAGAAGG + Intronic
968845186 4:3037091-3037113 GTGTGTGTGTGTGAGAAAGAGGG + Intronic
969125272 4:4943216-4943238 CTCTGAGTTTGTGAGAACCAAGG - Intergenic
970071600 4:12165597-12165619 CATCCAGTATGGGAGAAAGATGG - Intergenic
970196663 4:13557787-13557809 CCTTGAGAAGGTGAGACAGATGG + Intergenic
970356601 4:15259917-15259939 CTTGGAGTGTCTGGGAAAGAAGG - Intergenic
970848865 4:20577568-20577590 CCTTGAGTATGTAACAAATAGGG + Intronic
970898676 4:21133227-21133249 CATTGTGTATGTGAGGAAGTAGG - Intronic
971029001 4:22616818-22616840 CATCCAGTATGGGAGAAAGATGG - Intergenic
971063935 4:23005796-23005818 AATTGAGTATGTTAGCAAGATGG + Intergenic
971298198 4:25419338-25419360 CCTTGAGAGTGTGAGAAATATGG + Intergenic
972123941 4:35740477-35740499 CATTCAGCATGGGAGAAAGATGG - Intergenic
972264363 4:37444782-37444804 CTTTTAGAGTGTGATAAAGATGG + Exonic
972683942 4:41333588-41333610 TTTGGAGTATGAGAGAATGAGGG + Intergenic
973705259 4:53574505-53574527 TTCTGAGTTTGGGAGAAAGATGG - Intronic
974255301 4:59445594-59445616 CTATGACTTTTTGAGAAAGAAGG - Intergenic
974769305 4:66389910-66389932 CTATGAGTATATGAGAAAAAGGG + Intergenic
975271486 4:72439727-72439749 ATTTCATTTTGTGAGAAAGATGG - Intronic
975356300 4:73409177-73409199 CTTTAAGTATGTGGAAAAAAGGG - Intronic
976525330 4:86081213-86081235 TTTTGTGTATGTGTGAAAGAAGG - Intronic
979523938 4:121697693-121697715 ATATGAGTATATGAGAGAGAGGG + Intergenic
981432137 4:144673308-144673330 CTTTGAAACTATGAGAAAGAAGG - Intronic
983675528 4:170288134-170288156 CTTTGCTTAGGTGAGAGAGATGG - Intergenic
983955444 4:173692433-173692455 CTCTGAGTGTCAGAGAAAGAGGG - Intergenic
984461608 4:180044096-180044118 ATTTCAATATGTGAAAAAGAAGG - Intergenic
984842027 4:184077546-184077568 CTCTGAAGATGTGAGAAGGAAGG + Intergenic
986857626 5:11889127-11889149 CTTTGAGTCTTACAGAAAGAAGG - Intronic
987747701 5:21997702-21997724 TTTTGACTATGAGAGAAAGAAGG - Intronic
987905283 5:24068918-24068940 CATTCAGGATGGGAGAAAGATGG + Intronic
987920898 5:24279226-24279248 CATTAAGTATGTCTGAAAGAAGG + Intergenic
988361056 5:30237107-30237129 CATTCAGCATGGGAGAAAGATGG - Intergenic
989134807 5:38143207-38143229 GTTAAAGTCTGTGAGAAAGAGGG + Intergenic
989651250 5:43692947-43692969 CTTTGAGTATGTGAGAAAGAAGG - Intronic
990506298 5:56448815-56448837 TTTTGCTTATGTGATAAAGAGGG - Intergenic
991767879 5:70007495-70007517 TTTTGAGTATGAGAGAAAGAAGG - Intergenic
991847113 5:70882573-70882595 TTTTGAGTATGAGAGAAAGAAGG - Intergenic
992466975 5:77015756-77015778 CTTTGATTACCTGAGATAGAAGG + Intergenic
992502258 5:77354761-77354783 CTGTCATTAAGTGAGAAAGAAGG - Intronic
993999020 5:94755761-94755783 AGTTGAGTATGAGAGGAAGAGGG - Intronic
994086195 5:95761999-95762021 CTTTGAGAATTTGAGGAGGAAGG + Intronic
994543379 5:101129511-101129533 CTTTGAGGATATTGGAAAGAAGG + Intergenic
996868069 5:128152800-128152822 CTTTAGGTAAGTGATAAAGAAGG + Exonic
998323797 5:141260137-141260159 CTTTATGCATGTAAGAAAGATGG + Intergenic
998633570 5:143927926-143927948 TTTTGTGGATGTGAGAATGATGG + Intergenic
999659983 5:153850908-153850930 CATCCAGTATGGGAGAAAGATGG + Intergenic
1000182274 5:158822907-158822929 CTTTCAGGTTGAGAGAAAGAAGG - Intronic
1000448184 5:161350786-161350808 CATTGAGCATGGGAGAAAGATGG - Intronic
1001150166 5:169220277-169220299 CTTCCAGTTTGTGAGGAAGAGGG - Intronic
1001327186 5:170737664-170737686 CTTTGAGTCTGTGTAACAGATGG + Intergenic
1001872312 5:175167496-175167518 CTAGCAGGATGTGAGAAAGAAGG + Intergenic
1004619035 6:17317204-17317226 CTTGGAGTATGGGAGCAAAAAGG + Intergenic
1004920380 6:20370363-20370385 CTCTGAGGATGTGGGAAGGATGG - Intergenic
1005774348 6:29114419-29114441 ATTTGAGTAGGTGAGAAACCAGG - Intergenic
1005780239 6:29184030-29184052 ATTTGAGTAGGTGAGAAACCAGG - Intergenic
1006108665 6:31731128-31731150 ATTTCAGTAAGTGAGAAGGAAGG - Intronic
1007507923 6:42350982-42351004 GTTTGTGTGTGTGAGAGAGAGGG - Intronic
1007978502 6:46126171-46126193 CTTTGACTATGGGAGTCAGATGG - Intergenic
1008561064 6:52725157-52725179 CCTGGAGTATGTAAGCAAGAGGG - Intergenic
1010593584 6:77738036-77738058 CTTTGAGGCAGTGAGAAAGATGG + Intronic
1012188394 6:96250247-96250269 TTGTCAGTATGTCAGAAAGAAGG + Intergenic
1013056296 6:106586452-106586474 GTTTGAGTCTGGGAGACAGAGGG - Intronic
1013185439 6:107753794-107753816 CTTTGAGTAGGTGAGAGGGTAGG + Intronic
1014725962 6:124972098-124972120 CTTTGAGCATGTGGCAAACAAGG - Intronic
1017853451 6:158326990-158327012 ATTTGAGTATGTGAGAATTTGGG + Intronic
1018157100 6:160995337-160995359 CATAAAGTATGTGACAAAGATGG - Intronic
1018564010 6:165132496-165132518 CATCCAGTATGGGAGAAAGATGG + Intergenic
1020408949 7:7868875-7868897 CCTAGAGTATCTGAAAAAGAAGG + Intronic
1022177350 7:27884531-27884553 ACTTGAGTATGTGAGGAGGAAGG - Intronic
1022827676 7:34032900-34032922 CTGAGAGGATTTGAGAAAGAGGG + Intronic
1023024778 7:36040618-36040640 CTGTGAGAATTTGACAAAGAGGG + Intergenic
1023138804 7:37080692-37080714 CTTTGAGAAGGTGAGGAAGGTGG - Intronic
1025853822 7:65262019-65262041 CTTTCAGGAAGGGAGAAAGAAGG - Intergenic
1026192759 7:68144586-68144608 CTTCCAGCATGAGAGAAAGACGG - Intergenic
1027729460 7:81851799-81851821 TTCTGAGTGTGTGAAAAAGATGG - Intergenic
1028212645 7:88094002-88094024 CATTGAGTATCTGAGAATTATGG - Intronic
1030410283 7:109168921-109168943 TTTTTAGGAAGTGAGAAAGAAGG + Intergenic
1030622241 7:111802460-111802482 TTTTGGGTATGTGTGAAAAAAGG + Intronic
1031492489 7:122406174-122406196 CTTTGAGTCTGTGATAAAACTGG - Intronic
1032155808 7:129466795-129466817 CTTGGAGTATGGGGGAAAGGGGG - Intronic
1032328126 7:130951266-130951288 CTTTGAGAAGGTGAGAGGGAAGG + Intergenic
1033078534 7:138272050-138272072 TTTTGTGTATGTGTGAAACAGGG - Intergenic
1033141973 7:138835492-138835514 CTTTGAGCATTGCAGAAAGAGGG - Intronic
1033876851 7:145831754-145831776 CTTTAAGTCTGTGAGGCAGAAGG + Intergenic
1035718856 8:1775604-1775626 CTTTCAGTAAGTGAGGAAAATGG + Intronic
1036011418 8:4729610-4729632 CTGTGAGCAGGTGAGAAAGGGGG + Intronic
1036279164 8:7384683-7384705 TTTTGGGTGTGGGAGAAAGATGG + Intronic
1036342352 8:7927190-7927212 TTTTGGGTGTGGGAGAAAGATGG - Intronic
1037177775 8:15967151-15967173 CATCCAGTATGGGAGAAAGATGG - Intergenic
1037395189 8:18434195-18434217 CTTTGGGTTTGTTAGAAAAACGG - Intergenic
1037915444 8:22770161-22770183 CTTTGTGTGAATGAGAAAGAAGG + Intronic
1038079218 8:24114156-24114178 CTTTGAGTATGGAATAAAGTGGG + Intergenic
1039279996 8:35974094-35974116 GTTTGAGTTTGTGAGAGAAATGG + Intergenic
1040282675 8:46072918-46072940 CTTTGAAGATTTGAGAAAAATGG - Intergenic
1040794613 8:51275097-51275119 CTTTTAGTCTGTCAGGAAGATGG + Intergenic
1041118748 8:54565653-54565675 GTTAGGGTATGTGAGAAACAAGG + Intergenic
1041228929 8:55729928-55729950 CTTTTGGTATCTGAGAAAGATGG + Intronic
1041519743 8:58742181-58742203 CTTGGAATTTGTGATAAAGAAGG - Intergenic
1041989835 8:63973582-63973604 CTCTGAGGATGTTAGAAAAATGG + Intergenic
1043488002 8:80717907-80717929 CTGTAAATATGTGAGAGAGAAGG - Intronic
1044257352 8:90081554-90081576 CTTTTACTGTGTGAGAAATAAGG - Intronic
1045666829 8:104496971-104496993 CTCTGAGAATGTTTGAAAGAAGG - Exonic
1046502633 8:115097984-115098006 CTATGTATATGTGAGAAATATGG - Intergenic
1048821174 8:138382160-138382182 CTTGGAGTGTGTGAGAAGGTTGG - Intronic
1050071198 9:1816304-1816326 CTTTCAGTCTGTGAGCAGGAGGG + Intergenic
1050193486 9:3055093-3055115 TGTTGAGTGTGTGAGAATGAAGG - Intergenic
1052957489 9:34264691-34264713 ATTTGAGTCTGTGAGGAACAGGG - Intronic
1053444459 9:38141070-38141092 CTTTGAGTATCGGAAGAAGAAGG + Intergenic
1053480624 9:38414024-38414046 GTGTGTGTGTGTGAGAAAGAGGG - Intronic
1054815072 9:69466805-69466827 CTGGGAGTGTGTGAGAGAGAAGG + Intronic
1055365509 9:75540184-75540206 CTTTGGGCACATGAGAAAGATGG - Intergenic
1056318328 9:85413422-85413444 CTGTGAGTGTATGTGAAAGAAGG + Intergenic
1056941873 9:90962855-90962877 CTTTGAGTAAGAGGGCAAGATGG - Intergenic
1057401223 9:94725492-94725514 CTTGGAGAAAGTGAGAAAGTAGG - Intergenic
1058302519 9:103393758-103393780 CATTCAGCATGGGAGAAAGATGG + Intergenic
1058924082 9:109644340-109644362 CTTTGAATATGAGTGAAATAGGG + Intronic
1059624969 9:116053666-116053688 CTTTGACTAGATGAGAGAGAGGG - Intergenic
1061442403 9:130614889-130614911 TTCTGAGTATGTGAGTAACAGGG - Intronic
1203461548 Un_GL000220v1:44225-44247 CTTTGTGTATTTGAGCAAGATGG - Intergenic
1186183206 X:6992927-6992949 CATTCAGCATGGGAGAAAGATGG - Intergenic
1186358089 X:8808365-8808387 GTTTGAGTATGTAGGAGAGAGGG + Intergenic
1186617371 X:11203363-11203385 GTTTGAGTTTGTTAGAAAAATGG - Intronic
1187096877 X:16158065-16158087 CTCTGAGTAGGGGAGAAGGAGGG - Intergenic
1187715477 X:22098158-22098180 CTGTGTGTATGTGAGAGTGAGGG + Intronic
1188620824 X:32221290-32221312 CTTTGATTAGGTGAGGAGGAGGG + Intronic
1188820158 X:34765369-34765391 CTGAGAGGATGGGAGAAAGAGGG - Intergenic
1189008352 X:37018603-37018625 CTTTTATTCTCTGAGAAAGAAGG - Intergenic
1191927786 X:66333152-66333174 TTTTGAGTATGATAAAAAGAAGG + Intergenic
1192390158 X:70717560-70717582 CTTTGAGAAGCTGAGGAAGATGG - Intronic
1192635145 X:72808701-72808723 CTTGGAAAATGTGAGAGAGAGGG + Intronic
1192646570 X:72912102-72912124 CTTGGAAAATGTGAGAGAGAGGG - Intronic
1192781631 X:74299020-74299042 GTTTGAATATGTGAATAAGATGG + Intergenic
1193478918 X:82002638-82002660 CTTTTATTCTGTGGGAAAGAAGG + Intergenic
1194102661 X:89725807-89725829 CATTGTATATGTGATAAAGAAGG - Intergenic
1195271663 X:103237159-103237181 CATTCAGCATGGGAGAAAGATGG + Intergenic
1196061651 X:111414220-111414242 CTCTGAAGAAGTGAGAAAGAAGG - Intergenic
1196071788 X:111532387-111532409 CCAAGAGTATGGGAGAAAGAGGG - Intergenic
1197146925 X:123182152-123182174 CTTTTACTAGGTGAGAAAGAGGG + Intergenic
1197270298 X:124417871-124417893 TATTGAGTGTGGGAGAAAGAGGG - Intronic
1197360521 X:125496998-125497020 ATTTGTGTGTGTGAGAGAGATGG + Intergenic
1197851231 X:130862561-130862583 CTCTGAGTATGTGTGTGAGAGGG + Intronic
1198619764 X:138493322-138493344 CTTTGAGACTCTGAAAAAGAGGG - Intergenic
1200455337 Y:3383799-3383821 CGTTGTATATGTGATAAAGAAGG - Intergenic