ID: 989651924

View in Genome Browser
Species Human (GRCh38)
Location 5:43700023-43700045
Sequence AAATCTGCACACTTTGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989651924_989651927 -9 Left 989651924 5:43700023-43700045 CCAAGAACAAAGTGTGCAGATTT 0: 1
1: 0
2: 1
3: 17
4: 189
Right 989651927 5:43700037-43700059 TGCAGATTTGGAGGTGATATTGG 0: 1
1: 0
2: 1
3: 22
4: 201
989651924_989651930 23 Left 989651924 5:43700023-43700045 CCAAGAACAAAGTGTGCAGATTT 0: 1
1: 0
2: 1
3: 17
4: 189
Right 989651930 5:43700069-43700091 ACATTATGTCCTGTCAAGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 100
989651924_989651929 -7 Left 989651924 5:43700023-43700045 CCAAGAACAAAGTGTGCAGATTT 0: 1
1: 0
2: 1
3: 17
4: 189
Right 989651929 5:43700039-43700061 CAGATTTGGAGGTGATATTGGGG 0: 1
1: 0
2: 1
3: 18
4: 213
989651924_989651928 -8 Left 989651924 5:43700023-43700045 CCAAGAACAAAGTGTGCAGATTT 0: 1
1: 0
2: 1
3: 17
4: 189
Right 989651928 5:43700038-43700060 GCAGATTTGGAGGTGATATTGGG 0: 1
1: 1
2: 0
3: 14
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989651924 Original CRISPR AAATCTGCACACTTTGTTCT TGG (reversed) Intronic
905046608 1:35008547-35008569 ATTTCTGCAGACTTTGTTGTTGG - Intronic
906402722 1:45517258-45517280 ACATAATCACACTTTGTTCTTGG - Intronic
908851307 1:68379333-68379355 AAATCTGCACCCTGGGTTCTTGG - Intergenic
909956084 1:81780811-81780833 AAATGTGCTTACTTTGTTGTAGG + Intronic
913140970 1:115941120-115941142 ACATCTGCACTCTTGGTTCTTGG - Intergenic
914975816 1:152360462-152360484 AAATCTGCACTTTTAGTTATGGG + Intergenic
915247341 1:154566066-154566088 AAATCTGCACGACTTGTTCCGGG - Intergenic
916887600 1:169085572-169085594 TAATCTTCACACCTTTTTCTTGG - Intergenic
917783822 1:178429975-178429997 AACTCTGCATACTTTATTCTAGG + Intronic
918471852 1:184883472-184883494 ATAACTGCGCTCTTTGTTCTTGG - Intronic
919065790 1:192691618-192691640 AACTCTTCACATTTTGTTCAAGG - Intergenic
921342857 1:214152121-214152143 AAATATTCACCATTTGTTCTTGG - Intergenic
922394749 1:225185269-225185291 AAATCTGTAAATTTTGTTTTAGG + Intronic
1063082827 10:2784401-2784423 TAATTTGCACAGTTTATTCTTGG - Intergenic
1063529842 10:6820589-6820611 AACTCTGCCCCCTTTGTTCCTGG + Intergenic
1068044831 10:51873006-51873028 ATATCTGCACCATTTGTTTTAGG + Intronic
1068506003 10:57899727-57899749 AAATCTGCAAACTTTGTTTCTGG - Intergenic
1070013267 10:72497697-72497719 AAGTCTCCACAGTTTGCTCTAGG + Intronic
1070081618 10:73194271-73194293 AAATATGGACACTTCCTTCTTGG + Intronic
1070206541 10:74268805-74268827 AAATCTGCACATTAAGTACTAGG - Intronic
1070466519 10:76729548-76729570 GAATCTGCACACTTGGTCATGGG - Intergenic
1072057472 10:91774407-91774429 AAATCGTCACACTTTATGCTGGG - Intergenic
1072506547 10:96073547-96073569 TAAGCTGCACAGTTGGTTCTGGG + Intergenic
1072724084 10:97800950-97800972 AACTCTGCTCTCTTTGTTCCTGG + Intergenic
1077574537 11:3372044-3372066 AAATCTGCACACTAGTTTATTGG - Intronic
1077647477 11:3938418-3938440 AAATGAGCACACATTGCTCTTGG - Intronic
1077985383 11:7346393-7346415 AAATCCGCCAACTCTGTTCTGGG - Intronic
1079303419 11:19299942-19299964 AAAGCTGCACTCTTTTGTCTGGG + Intergenic
1080394120 11:31874310-31874332 AAAGCGGCACTCTTTGTACTGGG + Intronic
1082635901 11:55593463-55593485 ATATCTGCAAATTTTATTCTTGG + Intergenic
1083388190 11:62328187-62328209 AAATCCTCACACTTTGTGCCTGG - Intergenic
1088991792 11:114960432-114960454 AAAGCAGCAGACTTGGTTCTAGG + Intergenic
1089032922 11:115352051-115352073 ACATCTGCACAATTTGTTATTGG - Intronic
1090498064 11:127234121-127234143 AAGTCTGCACCATCTGTTCTGGG - Intergenic
1090749076 11:129730276-129730298 AAATTCACAAACTTTGTTCTTGG + Intergenic
1093209504 12:16291163-16291185 AACTCTGCACATTTTATTCTGGG + Intergenic
1093668900 12:21848880-21848902 AAATCTGCAAAGTTTGTTTTTGG - Intronic
1093862809 12:24188471-24188493 AAATCTTCACTCATTGTTTTAGG - Intergenic
1095147918 12:38752669-38752691 AAATATGCTCAATCTGTTCTTGG + Intronic
1095253135 12:40001637-40001659 AAGTCAGCACTCTTTATTCTTGG + Intronic
1095368553 12:41438666-41438688 AAATTTATACACTTTTTTCTAGG - Intronic
1099544897 12:83966370-83966392 AAATCTGCCAACTTATTTCTGGG + Intergenic
1099796073 12:87401342-87401364 AAATTTGGAAACTTTGTTATTGG - Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102679484 12:114681688-114681710 AAGTCTGCAAAATTCGTTCTGGG - Intronic
1102996326 12:117353810-117353832 AAATCTCCACATTTTGGGCTGGG + Intronic
1103529537 12:121591276-121591298 AAGTTTGGACACTTTGTCCTAGG - Intergenic
1103865034 12:124044851-124044873 GACTCTGCAGACTCTGTTCTGGG - Intronic
1106594082 13:31122330-31122352 AGATCAGCACACTGTGTGCTTGG - Intergenic
1107763474 13:43707757-43707779 AAATCTTTCTACTTTGTTCTTGG - Intronic
1108305589 13:49128837-49128859 AAATCTGGAAGATTTGTTCTAGG - Intronic
1110655959 13:77999569-77999591 ACATCAGCACTCCTTGTTCTTGG - Intergenic
1111309563 13:86465450-86465472 AAATCTACAAACTATGTTTTTGG - Intergenic
1111741700 13:92213085-92213107 AAATCTCCTCCCTTTCTTCTGGG - Intronic
1113357712 13:109599029-109599051 AAATCTGCAATGTTTGTGCTAGG - Intergenic
1115344475 14:32327726-32327748 AGATCTGTACTCTTTGTACTGGG + Intergenic
1117761298 14:59031561-59031583 TTATCTGCACAAGTTGTTCTGGG + Intergenic
1119316790 14:73703202-73703224 AAATGTCCATCCTTTGTTCTAGG - Exonic
1120845247 14:89119532-89119554 AAATCTGCAGACTCTATACTGGG - Intergenic
1124357072 15:29003654-29003676 GAATCTGCACACGTGGTTTTGGG + Intronic
1124466527 15:29944804-29944826 AAATCTTCAGACTTTGATCCAGG - Intronic
1125637717 15:41203383-41203405 AAATCTGCACACTGAATTGTGGG + Intronic
1125778160 15:42237657-42237679 AAATCTACAGACTTGGCTCTTGG - Intronic
1126985544 15:54303089-54303111 AAATCTAGAAACTTTGTTATTGG + Intronic
1128540980 15:68532538-68532560 AAATCTGCTCAATATGTTCAAGG - Intergenic
1130677270 15:85964265-85964287 AAATGTGTAAATTTTGTTCTGGG - Intergenic
1134345197 16:13384231-13384253 AAATCTGCATTCATTGTCCTGGG - Intergenic
1134364913 16:13568288-13568310 AAATCAGCTCACTTTGTTGTGGG - Intergenic
1135690621 16:24534384-24534406 ACATCTGGACATTTTGTTGTTGG - Intergenic
1138235485 16:55378759-55378781 ACATCTGCACGGTTTATTCTTGG - Intergenic
1143943325 17:10566252-10566274 AAAGTTGAAAACTTTGTTCTGGG - Intergenic
1148616234 17:49002229-49002251 AAATTTGGACACTTTCTTTTGGG - Intronic
1148715034 17:49709882-49709904 AAGGCTGCACACTATGTTGTGGG + Intergenic
1149216696 17:54363449-54363471 AAATCTGTTCATTTTCTTCTAGG + Intergenic
1149288366 17:55191100-55191122 AGATCTGCACTCCTTGTTTTAGG - Intergenic
1149334709 17:55623739-55623761 AAATCTGGACATTTAGTTCTGGG + Intergenic
1149532481 17:57406684-57406706 AAATAAGCTCACTTTGTTGTTGG - Intronic
1150525559 17:65918817-65918839 ACATCTGCACACTTTATGCCTGG + Intronic
1152846045 17:82600305-82600327 GAATCTGCCCACTCTGTTGTGGG + Intronic
1153918260 18:9765367-9765389 CAGTCTTCACACTCTGTTCTAGG - Intronic
1158255090 18:55537348-55537370 CAATCTGCCCACCTTGGTCTGGG - Intronic
1161959403 19:7515596-7515618 AACTCTACACATGTTGTTCTTGG - Intronic
1163048093 19:14660086-14660108 AAAGCTGCACACTTTATCATTGG + Intronic
1164529303 19:29036043-29036065 ACATCTGCATACTTTATCCTGGG - Intergenic
1164738121 19:30557135-30557157 AAATCTGCACATTTTCTTGCAGG + Exonic
1164899343 19:31905216-31905238 ACATCTTCCCCCTTTGTTCTGGG - Intergenic
926505941 2:13716108-13716130 GAATCTGCAAACTGTGGTCTGGG - Intergenic
927005716 2:18846111-18846133 GAATCTCAACACTTTGTTCTAGG + Intergenic
927818172 2:26239248-26239270 AAATCTGTACAATGTATTCTAGG + Intronic
929897522 2:45974915-45974937 AAGCCTGCCCACTGTGTTCTTGG + Intronic
930482330 2:51964664-51964686 AAATCTGCACAATTTGATAAAGG - Intergenic
930917907 2:56716426-56716448 AAATCTGCAGATTTTGGTCCTGG + Intergenic
935950123 2:108321063-108321085 ATATTTTCACACTTTTTTCTTGG - Intergenic
937400205 2:121575909-121575931 GAATCTGCACCCTCTGTTGTTGG - Intronic
938441124 2:131334026-131334048 AAATGGGAAAACTTTGTTCTTGG - Intronic
938908388 2:135861308-135861330 AAATTTGCCCACTTTCTTGTAGG - Intronic
939783360 2:146477093-146477115 AAATTTGTACCCTTTCTTCTTGG + Intergenic
940316524 2:152333309-152333331 AGATTTGCACACTTTTTCCTTGG + Intergenic
940406212 2:153305400-153305422 AAATCTGCACACTGTGCTATTGG + Intergenic
943655963 2:190509292-190509314 AGATTTGCAGACTTTGTTCTTGG - Exonic
945317159 2:208381889-208381911 ATATCTGCACATTTGATTCTTGG + Intronic
945778349 2:214135436-214135458 AAACATGCATACTTTGTTATTGG - Intronic
947014712 2:225606265-225606287 ACCTCTGGACACTTTGATCTGGG - Intronic
947195264 2:227558372-227558394 AAATCAGTACAGTTTATTCTTGG + Intronic
947800236 2:232924830-232924852 AAAACTTCATACTTTTTTCTGGG + Intronic
948145810 2:235707488-235707510 ACATCTGCCCAGTGTGTTCTGGG - Intronic
948173034 2:235921348-235921370 ACATATGCATACATTGTTCTTGG - Intronic
1169977065 20:11341378-11341400 AACTCTGCACAAGTAGTTCTGGG - Intergenic
1170596005 20:17806486-17806508 AAATGTGCTCACTTTATTCAGGG - Intergenic
1171065232 20:22008719-22008741 AAATCTGCTCCCTATTTTCTGGG - Intergenic
1172358592 20:34296645-34296667 AAGTCTGCAAACTTTGACCTAGG - Intronic
1172707288 20:36891511-36891533 CTAACTGCAGACTTTGTTCTTGG + Exonic
1173994387 20:47326539-47326561 AAATCTTCAGTCTTGGTTCTGGG + Intronic
1178574073 21:33769539-33769561 AAATCTGCACACCGTGATCTTGG - Intronic
1178729590 21:35087940-35087962 AAATCCTCCGACTTTGTTCTTGG - Intronic
1184581597 22:45421744-45421766 AAATCTTCACATTTTGCTTTTGG + Intronic
949116316 3:329317-329339 AAATATGAACACTTGATTCTGGG + Intronic
949556221 3:5155744-5155766 AACTCTGAACACTTTCTTTTTGG + Intronic
950452699 3:13074086-13074108 ATATCTGCACACTTACTTCCTGG - Intergenic
952204903 3:31171380-31171402 AAATCTACATACTTTGTCTTAGG - Intergenic
952633420 3:35497714-35497736 AAATCTGGAGAATTTGTTCCTGG - Intergenic
953135883 3:40181354-40181376 AAATGAGCACACTTTGCACTGGG + Intronic
955646807 3:61148312-61148334 ATAACTGCATACTTTGTTTTAGG - Intronic
956164449 3:66385809-66385831 AAATCTGCAAAACTTGCTCTGGG + Intronic
959015254 3:101126744-101126766 AAAGATGCATACTATGTTCTTGG + Intergenic
960079478 3:113525979-113526001 AAATCTGCTGAATTAGTTCTAGG - Intergenic
961616638 3:128188025-128188047 AAACATTTACACTTTGTTCTGGG + Intronic
970590532 4:17556299-17556321 AACTCTGCAAGCTTTTTTCTTGG - Intergenic
971150268 4:24023970-24023992 AAAGCTGCAGATTTTGTCCTGGG + Intergenic
971673988 4:29600507-29600529 AAATCTACAAACGTAGTTCTTGG + Intergenic
972328033 4:38036606-38036628 AAAACTGCACACTTGGTTTAGGG - Intronic
975792211 4:77966150-77966172 AAATTTGCAGACTCTATTCTAGG - Intergenic
977178485 4:93843638-93843660 AAAGCTGCATACTTTGCCCTAGG - Intergenic
978593753 4:110354837-110354859 CAATGTACACACTTTGTTCTAGG + Intergenic
978716328 4:111847417-111847439 ACATCTGGAAACTTTGATCTGGG - Intergenic
979048051 4:115894806-115894828 AACTCTGCCCACTTTGTATTTGG - Intergenic
979313005 4:119226405-119226427 AAAACTGCAACCTTAGTTCTAGG - Intronic
981421440 4:144554824-144554846 AAATGTGCACCTTTTGTTTTAGG - Intergenic
984727385 4:183034784-183034806 AAATGTACAGACTTTTTTCTTGG + Intergenic
988068391 5:26252885-26252907 AAATTTTGACACTTTGTTTTGGG + Intergenic
989651924 5:43700023-43700045 AAATCTGCACACTTTGTTCTTGG - Intronic
994462279 5:100079663-100079685 AAATCTTCAGACTTTATTTTTGG + Intergenic
995892940 5:116977022-116977044 GATTCAGCACACTCTGTTCTTGG + Intergenic
998547188 5:143039557-143039579 AACTCTGTACATTTTATTCTCGG - Intronic
998774956 5:145588840-145588862 AAATCCACACACTGTGTTTTAGG + Intronic
1000259329 5:159571581-159571603 AAATCTGCATTCTTTGTTGAGGG + Intergenic
1001893384 5:175358311-175358333 ACCTCTCCACACTTCGTTCTAGG + Intergenic
1004329476 6:14708414-14708436 AAATCTGCACTCTTTCCTCAAGG + Intergenic
1004885366 6:20046251-20046273 AAATCTGCATACATAGATCTAGG - Intergenic
1005128546 6:22475826-22475848 ATATCTGGACATTTTGTTATGGG + Intergenic
1005756911 6:28933156-28933178 AACCCTGCAGACTTTGATCTTGG - Intergenic
1007814962 6:44515249-44515271 AAATCATTACACTTTGTTCCTGG - Intergenic
1012326172 6:97920777-97920799 AAAACTGCATTCTTTATTCTGGG - Intergenic
1014213385 6:118730272-118730294 AAAAATGCACACATTGTTTTGGG + Intergenic
1014469403 6:121796812-121796834 ACATCAGCACTCTTGGTTCTTGG + Intergenic
1015092705 6:129377801-129377823 AAATCTGCACATAATTTTCTTGG - Intronic
1015765199 6:136708796-136708818 AATTCTGCATACTGTGTTCCTGG - Intronic
1015886012 6:137919510-137919532 TAATCTGAAAACTTTTTTCTTGG - Intergenic
1016158056 6:140838523-140838545 AAATATGCACTCTTTTCTCTTGG + Intergenic
1016470967 6:144374242-144374264 ATAACTCCATACTTTGTTCTAGG + Intronic
1018996011 6:168710933-168710955 AAATCTGCTGATTTTGTTCTCGG - Intergenic
1020825805 7:13026550-13026572 AAAAATACAAACTTTGTTCTGGG - Intergenic
1020896201 7:13943523-13943545 ACATATGCACCCTTTTTTCTTGG - Intronic
1021028022 7:15693506-15693528 ATTTCTACACATTTTGTTCTTGG + Intergenic
1021939030 7:25661155-25661177 AAACCTGCATGCTTTTTTCTAGG + Intergenic
1022353381 7:29587140-29587162 AAATCTGTACTCTTTGACCTAGG - Intergenic
1022681467 7:32550864-32550886 AATTCTGCACACTTTTTTGCTGG - Intronic
1023673421 7:42604146-42604168 AAATCTGCACCATTTGCTCTGGG + Intergenic
1024590811 7:50881256-50881278 AAATCTGCACAGATGGTTCATGG - Intergenic
1027883440 7:83872695-83872717 AAACCTACATACTTTTTTCTGGG + Intergenic
1028312029 7:89350729-89350751 AAATGTGCACACTTTCTTTGGGG - Intergenic
1028683129 7:93561629-93561651 AAAGAATCACACTTTGTTCTGGG - Intronic
1030762807 7:113371987-113372009 AAATCTGCACACTTGAGACTTGG + Intergenic
1032371789 7:131362466-131362488 AAGTCTGCATAGTTTGTACTAGG + Intronic
1036439764 8:8771436-8771458 AAATCTGCCCAGTTTCATCTAGG + Intergenic
1037197698 8:16211901-16211923 AAAACTGCTGACTTTGATCTGGG + Intronic
1037283285 8:17268140-17268162 AAATTTTCACACTTTGATATGGG - Intronic
1038857644 8:31350752-31350774 ACATCAGCACACCTTGTTATTGG - Intergenic
1044397879 8:91734990-91735012 TTATGTGCACACATTGTTCTAGG - Intergenic
1044615074 8:94131714-94131736 AAACCTGCACATTAAGTTCTAGG - Intronic
1045546156 8:103130567-103130589 GAAATTGCACACTTTGTTCATGG + Intergenic
1045876707 8:106990318-106990340 AAATATACACACTTCGTTGTGGG - Intergenic
1046585176 8:116141838-116141860 AAATATGCAGAGTTTTTTCTGGG - Intergenic
1048217187 8:132507053-132507075 GAAGCTTCACACTTTCTTCTGGG - Intergenic
1048232320 8:132656006-132656028 ACATGTGCACAGTTTTTTCTAGG - Intronic
1048516701 8:135117683-135117705 AAATCTGCAAACTCTCTTCCTGG + Intergenic
1050596388 9:7208480-7208502 AAATCTATACATTTGGTTCTGGG - Intergenic
1051815620 9:21102224-21102246 AAATCTGCACACTGTGTATAGGG + Intergenic
1052670277 9:31548238-31548260 AAGTCAGCACACTTTGGTATAGG - Intergenic
1056876208 9:90333523-90333545 AAATCTGAACACGATGTGCTAGG - Intergenic
1056900069 9:90590525-90590547 AAATGTGCAGACTGTGTTGTGGG - Intergenic
1058328223 9:103725262-103725284 CAATCTGCTCACTTTCTTGTTGG - Intergenic
1059615442 9:115945741-115945763 CAATCATCACACTTTGTACTTGG + Intergenic
1059775392 9:117469559-117469581 AAATCAGCACTCCTGGTTCTTGG - Intergenic
1060196599 9:121628172-121628194 GAATCTGCTGACTTTGTTCCTGG + Intronic
1186385117 X:9103140-9103162 AAAAATGCACACTGTGTTCTTGG + Intronic
1186666279 X:11720633-11720655 GAAACTCCACTCTTTGTTCTTGG + Intergenic
1188860185 X:35246040-35246062 AAATTTCCTCATTTTGTTCTAGG - Intergenic
1189338283 X:40184547-40184569 AAATCTGTACCCTTAGTCCTGGG + Intergenic
1192087744 X:68117702-68117724 AGGTCTCCACACTCTGTTCTAGG - Intronic
1193079103 X:77388232-77388254 AAATGTGCGGATTTTGTTCTGGG - Intergenic
1193451068 X:81667892-81667914 AAATTTATATACTTTGTTCTGGG + Intergenic
1194193400 X:90864697-90864719 GAATTTGCACACTTTGTTCTAGG - Intergenic
1194570631 X:95550664-95550686 AACTGTGCCCACTTTGTTTTGGG + Intergenic
1194986280 X:100492895-100492917 AAACCACCACATTTTGTTCTTGG + Intergenic
1195024051 X:100857729-100857751 GACTTTGCACACTTTGTTATGGG + Intronic
1197550107 X:127881616-127881638 CTATCTGCACAATATGTTCTAGG - Intergenic
1198017466 X:132625694-132625716 AAATGTGCACATTTTGTGTTTGG + Intergenic