ID: 989654138

View in Genome Browser
Species Human (GRCh38)
Location 5:43726427-43726449
Sequence AAAATGGGATAGCTACTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989654138_989654143 -3 Left 989654138 5:43726427-43726449 CCTTTGAGTAGCTATCCCATTTT No data
Right 989654143 5:43726447-43726469 TTTATAGATGTGGAAGCTCAGGG No data
989654138_989654149 28 Left 989654138 5:43726427-43726449 CCTTTGAGTAGCTATCCCATTTT No data
Right 989654149 5:43726478-43726500 ATTAAGTAGGTGGTGGCATCAGG No data
989654138_989654145 18 Left 989654138 5:43726427-43726449 CCTTTGAGTAGCTATCCCATTTT No data
Right 989654145 5:43726468-43726490 GGCCCAATTAATTAAGTAGGTGG No data
989654138_989654144 15 Left 989654138 5:43726427-43726449 CCTTTGAGTAGCTATCCCATTTT No data
Right 989654144 5:43726465-43726487 CAGGGCCCAATTAATTAAGTAGG No data
989654138_989654142 -4 Left 989654138 5:43726427-43726449 CCTTTGAGTAGCTATCCCATTTT No data
Right 989654142 5:43726446-43726468 TTTTATAGATGTGGAAGCTCAGG No data
989654138_989654148 21 Left 989654138 5:43726427-43726449 CCTTTGAGTAGCTATCCCATTTT No data
Right 989654148 5:43726471-43726493 CCAATTAATTAAGTAGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989654138 Original CRISPR AAAATGGGATAGCTACTCAA AGG (reversed) Intergenic
No off target data available for this crispr