ID: 989654140

View in Genome Browser
Species Human (GRCh38)
Location 5:43726442-43726464
Sequence AGCTTCCACATCTATAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11922
Summary {0: 4, 1: 51, 2: 568, 3: 2811, 4: 8488}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989654140_989654145 3 Left 989654140 5:43726442-43726464 CCCATTTTATAGATGTGGAAGCT 0: 4
1: 51
2: 568
3: 2811
4: 8488
Right 989654145 5:43726468-43726490 GGCCCAATTAATTAAGTAGGTGG No data
989654140_989654148 6 Left 989654140 5:43726442-43726464 CCCATTTTATAGATGTGGAAGCT 0: 4
1: 51
2: 568
3: 2811
4: 8488
Right 989654148 5:43726471-43726493 CCAATTAATTAAGTAGGTGGTGG No data
989654140_989654149 13 Left 989654140 5:43726442-43726464 CCCATTTTATAGATGTGGAAGCT 0: 4
1: 51
2: 568
3: 2811
4: 8488
Right 989654149 5:43726478-43726500 ATTAAGTAGGTGGTGGCATCAGG No data
989654140_989654151 26 Left 989654140 5:43726442-43726464 CCCATTTTATAGATGTGGAAGCT 0: 4
1: 51
2: 568
3: 2811
4: 8488
Right 989654151 5:43726491-43726513 TGGCATCAGGATTTGAATCTGGG No data
989654140_989654144 0 Left 989654140 5:43726442-43726464 CCCATTTTATAGATGTGGAAGCT 0: 4
1: 51
2: 568
3: 2811
4: 8488
Right 989654144 5:43726465-43726487 CAGGGCCCAATTAATTAAGTAGG No data
989654140_989654150 25 Left 989654140 5:43726442-43726464 CCCATTTTATAGATGTGGAAGCT 0: 4
1: 51
2: 568
3: 2811
4: 8488
Right 989654150 5:43726490-43726512 GTGGCATCAGGATTTGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989654140 Original CRISPR AGCTTCCACATCTATAAAAT GGG (reversed) Intergenic
Too many off-targets to display for this crispr