ID: 989654141

View in Genome Browser
Species Human (GRCh38)
Location 5:43726443-43726465
Sequence GAGCTTCCACATCTATAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989654141_989654150 24 Left 989654141 5:43726443-43726465 CCATTTTATAGATGTGGAAGCTC No data
Right 989654150 5:43726490-43726512 GTGGCATCAGGATTTGAATCTGG No data
989654141_989654149 12 Left 989654141 5:43726443-43726465 CCATTTTATAGATGTGGAAGCTC No data
Right 989654149 5:43726478-43726500 ATTAAGTAGGTGGTGGCATCAGG No data
989654141_989654151 25 Left 989654141 5:43726443-43726465 CCATTTTATAGATGTGGAAGCTC No data
Right 989654151 5:43726491-43726513 TGGCATCAGGATTTGAATCTGGG No data
989654141_989654144 -1 Left 989654141 5:43726443-43726465 CCATTTTATAGATGTGGAAGCTC No data
Right 989654144 5:43726465-43726487 CAGGGCCCAATTAATTAAGTAGG No data
989654141_989654145 2 Left 989654141 5:43726443-43726465 CCATTTTATAGATGTGGAAGCTC No data
Right 989654145 5:43726468-43726490 GGCCCAATTAATTAAGTAGGTGG No data
989654141_989654148 5 Left 989654141 5:43726443-43726465 CCATTTTATAGATGTGGAAGCTC No data
Right 989654148 5:43726471-43726493 CCAATTAATTAAGTAGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989654141 Original CRISPR GAGCTTCCACATCTATAAAA TGG (reversed) Intergenic
No off target data available for this crispr