ID: 989654144

View in Genome Browser
Species Human (GRCh38)
Location 5:43726465-43726487
Sequence CAGGGCCCAATTAATTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989654141_989654144 -1 Left 989654141 5:43726443-43726465 CCATTTTATAGATGTGGAAGCTC No data
Right 989654144 5:43726465-43726487 CAGGGCCCAATTAATTAAGTAGG No data
989654140_989654144 0 Left 989654140 5:43726442-43726464 CCCATTTTATAGATGTGGAAGCT 0: 4
1: 51
2: 568
3: 2811
4: 8488
Right 989654144 5:43726465-43726487 CAGGGCCCAATTAATTAAGTAGG No data
989654138_989654144 15 Left 989654138 5:43726427-43726449 CCTTTGAGTAGCTATCCCATTTT No data
Right 989654144 5:43726465-43726487 CAGGGCCCAATTAATTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989654144 Original CRISPR CAGGGCCCAATTAATTAAGT AGG Intergenic
No off target data available for this crispr