ID: 989657480

View in Genome Browser
Species Human (GRCh38)
Location 5:43760240-43760262
Sequence TGCCTGGGCAATGCTGTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989657476_989657480 -7 Left 989657476 5:43760224-43760246 CCTGGGTCTCTGTGTGTGCCTGG No data
Right 989657480 5:43760240-43760262 TGCCTGGGCAATGCTGTGCCGGG No data
989657472_989657480 25 Left 989657472 5:43760192-43760214 CCGGGGATCCTGGGGCATGAGTT No data
Right 989657480 5:43760240-43760262 TGCCTGGGCAATGCTGTGCCGGG No data
989657473_989657480 17 Left 989657473 5:43760200-43760222 CCTGGGGCATGAGTTTGTAACAC No data
Right 989657480 5:43760240-43760262 TGCCTGGGCAATGCTGTGCCGGG No data
989657471_989657480 30 Left 989657471 5:43760187-43760209 CCTTGCCGGGGATCCTGGGGCAT No data
Right 989657480 5:43760240-43760262 TGCCTGGGCAATGCTGTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989657480 Original CRISPR TGCCTGGGCAATGCTGTGCC GGG Intergenic
No off target data available for this crispr