ID: 989657493

View in Genome Browser
Species Human (GRCh38)
Location 5:43760297-43760319
Sequence CTGGTGGCATGGACTTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989657483_989657493 8 Left 989657483 5:43760266-43760288 CCACACAGCTCTGTGTATTAGAC No data
Right 989657493 5:43760297-43760319 CTGGTGGCATGGACTTATGAGGG No data
989657482_989657493 16 Left 989657482 5:43760258-43760280 CCGGGACTCCACACAGCTCTGTG No data
Right 989657493 5:43760297-43760319 CTGGTGGCATGGACTTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989657493 Original CRISPR CTGGTGGCATGGACTTATGA GGG Intergenic
No off target data available for this crispr