ID: 989662740

View in Genome Browser
Species Human (GRCh38)
Location 5:43816649-43816671
Sequence CAGTGTTAGAGGAAGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989662734_989662740 5 Left 989662734 5:43816621-43816643 CCCAAATCTCATGTTCAATTGTA 0: 123
1: 1479
2: 11071
3: 13459
4: 8491
Right 989662740 5:43816649-43816671 CAGTGTTAGAGGAAGGGGTCTGG No data
989662733_989662740 8 Left 989662733 5:43816618-43816640 CCACCCAAATCTCATGTTCAATT 0: 110
1: 1310
2: 11509
3: 15519
4: 12146
Right 989662740 5:43816649-43816671 CAGTGTTAGAGGAAGGGGTCTGG No data
989662735_989662740 4 Left 989662735 5:43816622-43816644 CCAAATCTCATGTTCAATTGTAA 0: 127
1: 1524
2: 6514
3: 14957
4: 13708
Right 989662740 5:43816649-43816671 CAGTGTTAGAGGAAGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989662740 Original CRISPR CAGTGTTAGAGGAAGGGGTC TGG Intergenic
No off target data available for this crispr