ID: 989664923

View in Genome Browser
Species Human (GRCh38)
Location 5:43842735-43842757
Sequence CATGATAACCAAAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989664914_989664923 25 Left 989664914 5:43842687-43842709 CCCTGAGGTGGAGAGAAGTGTGG No data
Right 989664923 5:43842735-43842757 CATGATAACCAAAGGGAAGAGGG No data
989664916_989664923 24 Left 989664916 5:43842688-43842710 CCTGAGGTGGAGAGAAGTGTGGC No data
Right 989664923 5:43842735-43842757 CATGATAACCAAAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989664923 Original CRISPR CATGATAACCAAAGGGAAGA GGG Intergenic
No off target data available for this crispr