ID: 989665164

View in Genome Browser
Species Human (GRCh38)
Location 5:43845775-43845797
Sequence CCTTATCTACATATGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989665159_989665164 -3 Left 989665159 5:43845755-43845777 CCATTTTAGGCTTCACCTTCCCT No data
Right 989665164 5:43845775-43845797 CCTTATCTACATATGAAGCTGGG No data
989665157_989665164 25 Left 989665157 5:43845727-43845749 CCAACAGGGTGGTATAGTTAATC No data
Right 989665164 5:43845775-43845797 CCTTATCTACATATGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989665164 Original CRISPR CCTTATCTACATATGAAGCT GGG Intergenic
No off target data available for this crispr