ID: 989669662

View in Genome Browser
Species Human (GRCh38)
Location 5:43900892-43900914
Sequence CAGTGTGAGCAGAGTGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989669662_989669665 2 Left 989669662 5:43900892-43900914 CCTAGAACACTCTGCTCACACTG No data
Right 989669665 5:43900917-43900939 CTTTTTCCTTTTCTTTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989669662 Original CRISPR CAGTGTGAGCAGAGTGTTCT AGG (reversed) Intergenic
No off target data available for this crispr