ID: 989672498

View in Genome Browser
Species Human (GRCh38)
Location 5:43935505-43935527
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989672490_989672498 25 Left 989672490 5:43935457-43935479 CCTCAGCAGTGATGGAGTGGTGC No data
Right 989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG No data
989672487_989672498 30 Left 989672487 5:43935452-43935474 CCAACCCTCAGCAGTGATGGAGT No data
Right 989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG No data
989672489_989672498 26 Left 989672489 5:43935456-43935478 CCCTCAGCAGTGATGGAGTGGTG No data
Right 989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr