ID: 989672554

View in Genome Browser
Species Human (GRCh38)
Location 5:43935967-43935989
Sequence CTATTTTGCCAGGGCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989672554_989672559 12 Left 989672554 5:43935967-43935989 CCAGCTGAGCCCTGGCAAAATAG No data
Right 989672559 5:43936002-43936024 AGTCACAATGCCCTCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989672554 Original CRISPR CTATTTTGCCAGGGCTCAGC TGG (reversed) Intergenic
No off target data available for this crispr