ID: 989676838

View in Genome Browser
Species Human (GRCh38)
Location 5:43982632-43982654
Sequence TGGATGATGAGGGACTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989676838_989676842 -5 Left 989676838 5:43982632-43982654 CCTTCCAAGTCCCTCATCATCCA No data
Right 989676842 5:43982650-43982672 ATCCAGCCAAACCATTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989676838 Original CRISPR TGGATGATGAGGGACTTGGA AGG (reversed) Intergenic
No off target data available for this crispr