ID: 989677025

View in Genome Browser
Species Human (GRCh38)
Location 5:43984164-43984186
Sequence CAAAATGCTGACAGTGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989677025_989677028 4 Left 989677025 5:43984164-43984186 CCCATGTCACTGTCAGCATTTTG No data
Right 989677028 5:43984191-43984213 AAACCATTAAACAAGTCTCTAGG No data
989677025_989677030 12 Left 989677025 5:43984164-43984186 CCCATGTCACTGTCAGCATTTTG No data
Right 989677030 5:43984199-43984221 AAACAAGTCTCTAGGAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989677025 Original CRISPR CAAAATGCTGACAGTGACAT GGG (reversed) Intergenic