ID: 989677829

View in Genome Browser
Species Human (GRCh38)
Location 5:43992959-43992981
Sequence AGGGAGAAACACTATGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989677827_989677829 -9 Left 989677827 5:43992945-43992967 CCTGAATGGGAAAGAGGGAGAAA No data
Right 989677829 5:43992959-43992981 AGGGAGAAACACTATGAGTTGGG No data
989677824_989677829 3 Left 989677824 5:43992933-43992955 CCTAATGAATAGCCTGAATGGGA No data
Right 989677829 5:43992959-43992981 AGGGAGAAACACTATGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989677829 Original CRISPR AGGGAGAAACACTATGAGTT GGG Intergenic
No off target data available for this crispr