ID: 989681357

View in Genome Browser
Species Human (GRCh38)
Location 5:44032811-44032833
Sequence CAGTATTAGAACAAAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989681348_989681357 21 Left 989681348 5:44032767-44032789 CCATAGGGGTGCTTATGTCTTTT No data
Right 989681357 5:44032811-44032833 CAGTATTAGAACAAAGAGAGAGG No data
989681352_989681357 -7 Left 989681352 5:44032795-44032817 CCAGCTTCTTCACCCCCAGTATT No data
Right 989681357 5:44032811-44032833 CAGTATTAGAACAAAGAGAGAGG No data
989681349_989681357 -4 Left 989681349 5:44032792-44032814 CCCCCAGCTTCTTCACCCCCAGT No data
Right 989681357 5:44032811-44032833 CAGTATTAGAACAAAGAGAGAGG No data
989681351_989681357 -6 Left 989681351 5:44032794-44032816 CCCAGCTTCTTCACCCCCAGTAT No data
Right 989681357 5:44032811-44032833 CAGTATTAGAACAAAGAGAGAGG No data
989681350_989681357 -5 Left 989681350 5:44032793-44032815 CCCCAGCTTCTTCACCCCCAGTA No data
Right 989681357 5:44032811-44032833 CAGTATTAGAACAAAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989681357 Original CRISPR CAGTATTAGAACAAAGAGAG AGG Intergenic
No off target data available for this crispr