ID: 989683581

View in Genome Browser
Species Human (GRCh38)
Location 5:44058741-44058763
Sequence CCTGCTTTGCATGTGTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989683575_989683581 11 Left 989683575 5:44058707-44058729 CCCTCCCAATCTGACTTTAACGA No data
Right 989683581 5:44058741-44058763 CCTGCTTTGCATGTGTTGTGTGG No data
989683578_989683581 6 Left 989683578 5:44058712-44058734 CCAATCTGACTTTAACGAAGAGA No data
Right 989683581 5:44058741-44058763 CCTGCTTTGCATGTGTTGTGTGG No data
989683577_989683581 7 Left 989683577 5:44058711-44058733 CCCAATCTGACTTTAACGAAGAG No data
Right 989683581 5:44058741-44058763 CCTGCTTTGCATGTGTTGTGTGG No data
989683576_989683581 10 Left 989683576 5:44058708-44058730 CCTCCCAATCTGACTTTAACGAA No data
Right 989683581 5:44058741-44058763 CCTGCTTTGCATGTGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989683581 Original CRISPR CCTGCTTTGCATGTGTTGTG TGG Intergenic
No off target data available for this crispr