ID: 989684438

View in Genome Browser
Species Human (GRCh38)
Location 5:44068756-44068778
Sequence TGTGGTTCTAAAGCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989684438_989684443 21 Left 989684438 5:44068756-44068778 CCAGCAGCAGCTTTAGAACCACA No data
Right 989684443 5:44068800-44068822 GGTCAAAACAAAGACTACTCAGG No data
989684438_989684441 0 Left 989684438 5:44068756-44068778 CCAGCAGCAGCTTTAGAACCACA No data
Right 989684441 5:44068779-44068801 CAGGTCAGTCAGTGTCCAAGTGG No data
989684438_989684444 22 Left 989684438 5:44068756-44068778 CCAGCAGCAGCTTTAGAACCACA No data
Right 989684444 5:44068801-44068823 GTCAAAACAAAGACTACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989684438 Original CRISPR TGTGGTTCTAAAGCTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr