ID: 989685658

View in Genome Browser
Species Human (GRCh38)
Location 5:44083762-44083784
Sequence CTAAGGAAGTGGAGGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989685658_989685663 6 Left 989685658 5:44083762-44083784 CCATCTTGCCTCCACTTCCTTAG No data
Right 989685663 5:44083791-44083813 TAATTTTTCATATCAGTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989685658 Original CRISPR CTAAGGAAGTGGAGGCAAGA TGG (reversed) Intergenic
No off target data available for this crispr