ID: 989685937

View in Genome Browser
Species Human (GRCh38)
Location 5:44087372-44087394
Sequence GACTGAATTCCTTTACAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989685937_989685941 5 Left 989685937 5:44087372-44087394 CCATATTGTAAAGGAATTCAGTC No data
Right 989685941 5:44087400-44087422 TAGAACCATGGAATTTTGGTGGG No data
989685937_989685940 4 Left 989685937 5:44087372-44087394 CCATATTGTAAAGGAATTCAGTC No data
Right 989685940 5:44087399-44087421 TTAGAACCATGGAATTTTGGTGG No data
989685937_989685939 1 Left 989685937 5:44087372-44087394 CCATATTGTAAAGGAATTCAGTC No data
Right 989685939 5:44087396-44087418 AGTTTAGAACCATGGAATTTTGG No data
989685937_989685938 -7 Left 989685937 5:44087372-44087394 CCATATTGTAAAGGAATTCAGTC No data
Right 989685938 5:44087388-44087410 TTCAGTCTAGTTTAGAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989685937 Original CRISPR GACTGAATTCCTTTACAATA TGG (reversed) Intergenic
No off target data available for this crispr