ID: 989688704

View in Genome Browser
Species Human (GRCh38)
Location 5:44116776-44116798
Sequence TTGTAGAAGGAGTTGGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989688698_989688704 7 Left 989688698 5:44116746-44116768 CCATGCCTAGGAAGTAAAGGAGT No data
Right 989688704 5:44116776-44116798 TTGTAGAAGGAGTTGGGGCTTGG No data
989688699_989688704 2 Left 989688699 5:44116751-44116773 CCTAGGAAGTAAAGGAGTTGTTG No data
Right 989688704 5:44116776-44116798 TTGTAGAAGGAGTTGGGGCTTGG No data
989688696_989688704 11 Left 989688696 5:44116742-44116764 CCAACCATGCCTAGGAAGTAAAG No data
Right 989688704 5:44116776-44116798 TTGTAGAAGGAGTTGGGGCTTGG No data
989688695_989688704 12 Left 989688695 5:44116741-44116763 CCCAACCATGCCTAGGAAGTAAA No data
Right 989688704 5:44116776-44116798 TTGTAGAAGGAGTTGGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989688704 Original CRISPR TTGTAGAAGGAGTTGGGGCT TGG Intergenic
No off target data available for this crispr