ID: 989697863

View in Genome Browser
Species Human (GRCh38)
Location 5:44224864-44224886
Sequence GAGCAGAAAAGGGCAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989697863_989697867 1 Left 989697863 5:44224864-44224886 CCATTTTCTGCCCTTTTCTGCTC No data
Right 989697867 5:44224888-44224910 GATGCCTGCCATGGCATCCTTGG No data
989697863_989697868 2 Left 989697863 5:44224864-44224886 CCATTTTCTGCCCTTTTCTGCTC No data
Right 989697868 5:44224889-44224911 ATGCCTGCCATGGCATCCTTGGG No data
989697863_989697869 3 Left 989697863 5:44224864-44224886 CCATTTTCTGCCCTTTTCTGCTC No data
Right 989697869 5:44224890-44224912 TGCCTGCCATGGCATCCTTGGGG No data
989697863_989697874 29 Left 989697863 5:44224864-44224886 CCATTTTCTGCCCTTTTCTGCTC No data
Right 989697874 5:44224916-44224938 CCTTGACTTCCACTTCCAAATGG No data
989697863_989697866 -8 Left 989697863 5:44224864-44224886 CCATTTTCTGCCCTTTTCTGCTC No data
Right 989697866 5:44224879-44224901 TTCTGCTCTGATGCCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989697863 Original CRISPR GAGCAGAAAAGGGCAGAAAA TGG (reversed) Intergenic