ID: 989697865

View in Genome Browser
Species Human (GRCh38)
Location 5:44224875-44224897
Sequence GGCAGGCATCAGAGCAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989697865_989697868 -9 Left 989697865 5:44224875-44224897 CCTTTTCTGCTCTGATGCCTGCC No data
Right 989697868 5:44224889-44224911 ATGCCTGCCATGGCATCCTTGGG No data
989697865_989697867 -10 Left 989697865 5:44224875-44224897 CCTTTTCTGCTCTGATGCCTGCC No data
Right 989697867 5:44224888-44224910 GATGCCTGCCATGGCATCCTTGG No data
989697865_989697874 18 Left 989697865 5:44224875-44224897 CCTTTTCTGCTCTGATGCCTGCC No data
Right 989697874 5:44224916-44224938 CCTTGACTTCCACTTCCAAATGG No data
989697865_989697869 -8 Left 989697865 5:44224875-44224897 CCTTTTCTGCTCTGATGCCTGCC No data
Right 989697869 5:44224890-44224912 TGCCTGCCATGGCATCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989697865 Original CRISPR GGCAGGCATCAGAGCAGAAA AGG (reversed) Intergenic